RegulonDB RegulonDB 10.9: Gene Sequence
murC gene sequence


Size: 1476        A: 330  T: 338  G: 436  C: 372

Fasta

 

>murC E. coli K12. Version NC_000913.3 GI:556503834
atgaatacacaacaattggcaaaactgcgttccatcgtgcccgaaatgcgtcgcgttcgg
cacatacattttgtcggcattggtggtgccggtatgggcggtattgccgaagttctggcc
aatgaaggttatcagatcagtggttccgatttagcgccaaatccggtcacgcagcagtta
atgaatctgggtgcgacgatttatttcaaccatcgcccggaaaacgtacgtgatgccagc
gtggtcgttgtttccagcgcgatttctgccgataacccggaaattgtcgccgctcatgaa
gcgcgtattccggtgatccgtcgtgccgaaatgctggctgagttaatgcgttttcgtcat
ggcatcgccattgccggaacgcacggcaaaacgacaaccaccgcgatggtttccagcatc
tacgcagaagcggggctcgacccaaccttcgttaacggcgggctggtaaaagcggcgggg
gttcatgcgcgtttggggcatggtcggtacctgattgccgaagcagatgagagtgatgca
tcgttcctgcatctgcaaccgatggtggcgattgtcaccaatatcgaagccgaccacatg
gatacctaccagggcgactttgagaatttaaaacagacttttattaattttctgcacaac
ctgccgttttacggtcgtgcggtgatgtgtgttgatgatccggtgatccgcgaattgtta
ccgcgagtggggcgtcagaccacgacttacggcttcagcgaagatgccgacgtgcgtgta
gaagattatcagcagattggcccgcaggggcactttacgctgctgcgccaggacaaagag
ccgatgcgcgtcaccctgaatgcgccaggtcgtcataacgcgctgaacgccgcagctgcg
gttgcggttgctacggaagagggcattgacgacgaggctattttgcgggcgcttgaaagc
ttccaggggactggtcgccgttttgatttcctcggtgaattcccgctggagccagtgaat
ggtaaaagcggtacggcaatgctggtcgatgactacggccaccacccgacggaagtggac
gccaccattaaagcggcgcgcgcaggctggccggataaaaacctggtaatgctgtttcag
ccgcaccgttttacccgtacgcgcgacctgtatgatgatttcgccaatgtgctgacgcag
gttgataccctgttgatgctggaagtgtatccggctggcgaagcgccaattccgggagcg
gacagccgttcgctgtgtcgcacaattcgtggacgtgggaaaattgatcccattctggtg
ccggatccggcgcgggtagccgagatgctggcaccggtattaaccggtaacgacctgatt
ctcgttcagggggctggtaatattggaaaaattgcccgttctttagctgaaatcaaactg
aagccgcaaactccggaggaagaacaacatgactga
              
                            

Download fasta file
RegulonDB