RegulonDB RegulonDB 10.10: Gene Sequence
murE gene sequence


Size: 1488        A: 325  T: 321  G: 474  C: 368

Fasta

 

>murE E. coli K12. Version NC_000913.3 GI:556503834
gtggcagatcgtaatttgcgcgaccttcttgctccgtgggtgccagacgcaccttcgcga
gcactgcgagagatgacactcgacagccgtgtggctgcggcgggcgatctctttgtagct
gtagtaggtcatcaggcggacgggcgtcgatatatcccgcaggcgatagcgcaaggtgtg
gctgccattattgcagaggcgaaagatgaggcgaccgatggtgaaatccgtgaaatgcac
ggcgtaccggtcatctatctcagccagctcaacgagcgtttatctgcactggcgggccgc
ttttaccatgaaccctctgacaatttacgtctcgtgggcgtaacgggcaccaacggcaaa
accacgactacccagctgttggcgcagtggagccaactgcttggcgaaatcagcgcggta
atgggcaccgttggtaacggcctgctggggaaagtgatcccgacagaaaatacaaccggt
tcggcagtcgatgttcagcatgagctggcggggctggtggatcagggcgcgacgttttgc
gcaatggaagtttcctcccacgggctggtacagcaccgtgtggcggcattgaaatttgcg
gcgtcggtctttaccaacttaagccgcgatcaccttgattatcatggtgatatggaacac
tacgaagccgcgaaatggctgctttattctgagcatcattgcggtcaggcgattattaac
gccgacgatgaagtgggccgccgctggctggcaaaactgccggacgcggttgcggtatca
atggaagatcatattaatccgaactgtcacggacgctggttgaaagcgaccgaagtgaac
tatcacgacagcggtgcgacgattcgctttagctcaagttggggcgatggcgaaattgaa
agccatctgatgggcgcttttaacgtcagcaacctgctgctcgcgctggcgacactgttg
gcactcggctatccactggctgatctgctgaaaaccgccgcgcgtctgcaaccggtttgc
ggacgtatggaagtgttcactgcgccaggcaaaccgacggtggtggtggattacgcgcat
acgccggatgcactggaaaaagccttacaggcggcgcgtctgcactgtgcgggcaagctg
tggtgtgtctttggctgtggtggcgatcgcgataaaggtaagcgtccactgatgggcgca
attgccgaagagtttgctgacgtggcggtggtgacggacgataacccgcgtaccgaagaa
ccgcgtgccatcatcaacgatattctggcgggaatgttagatgccggacatgccaaagtg
atggaaggccgtgctgaagcggtgacttgcgccgttatgcaggctaaagagaatgatgtg
gtactggtcgcgggcaaaggccatgaagattaccagattgttggcaatcagcgtctggac
tactccgatcgcgtcacggtggcgcgtctgctgggggtgattgcatga
              
                            

Download fasta file
RegulonDB