RegulonDB RegulonDB 10.10: Gene Sequence
murF gene sequence


Size: 1359        A: 315  T: 295  G: 389  C: 360

Fasta

 

>murF E. coli K12. Version NC_000913.3 GI:556503834
atgattagcgtaacccttagccaacttaccgacattctcaacggtgaactgcaaggtgca
gatatcacccttgatgctgtaaccactgatacccgaaaactgacgccgggctgcctgttt
gttgccctgaaaggcgaacgttttgatgcccacgattttgccgaccaggcgaaagctggc
ggcgcaggcgcactactggttagccgtccgctggacatcgacctgccgcagttaatcgtc
aaggatacgcgtctggcgtttggtgaactggctgcatgggttcgccagcaagttccggcg
cgcgtggttgctctgacggggtcctccggcaaaacctccgttaaagagatgacggcggcg
attttaagccagtgcggcaacacgctttatacggcaggcaatctcaacaacgacatcggt
gtaccgatgacgctgttgcgcttaacgccggaatacgattacgcagttattgaacttggc
gcgaaccatcagggcgaaatagcctggactgtgagtctgactcgcccggaagctgcgctg
gtcaacaacctggcagcggcgcatctggaaggttttggctcgcttgcgggtgtcgcgaaa
gcgaaaggtgaaatctttagcggcctgccggaaaacggtatcgccattatgaacgccgac
aacaacgactggctgaactggcagagcgtaattggctcacgcaaagtgtggcgtttctca
cccaatgccgccaacagcgatttcaccgccaccaatatccatgtgacctcgcacggtacg
gaatttaccctacaaaccccaaccggtagcgtcgatgttctgctgccgttgccggggcgt
cacaatattgcgaatgcgctggcagccgctgcgctctccatgtccgtgggcgcaacgctt
gatgctatcaaagcggggctggcaaatctgaaagctgttccaggccgtctgttccccatc
caactggcagaaaaccagttgctgctcgacgactcctacaacgccaatgtcggttcaatg
actgcagcagtccaggtactggctgaaatgccgggctaccgcgtgctggtggtgggcgat
atggcggaactgggcgctgaaagcgaagcctgccatgtacaggtgggcgaggcggcaaaa
gctgctggtattgaccgcgtgttaagcgtgggtaaacaaagccatgctatcagcaccgcc
agcggcgttggcgaacattttgctgataaaactgcgttaattacgcgtcttaaattactg
attgctgagcaacaggtaattacgattttagttaagggttcacgtagtgccgccatggaa
gaggtagtacgcgctttacaggagaatgggacatgttag
              
                            

Download fasta file
RegulonDB