RegulonDB RegulonDB 10.10: Gene Sequence
murG gene sequence


Size: 1068        A: 236  T: 233  G: 344  C: 255

Fasta

 

>murG E. coli K12. Version NC_000913.3 GI:556503834
atgagtggtcaaggaaagcgattaatggtgatggcaggcggaaccggtggacatgtattc
ccgggactggcggttgcgcaccatctaatggctcagggttggcaagttcgctggctgggg
actgccgaccgtatggaagcggacttagtgccaaaacatggcatcgaaattgatttcatt
cgtatctctggtctgcgtggaaaaggtataaaagcactgatagctgccccgctgcgtatc
ttcaacgcctggcgtcaggcgcgggcgattatgaaagcgtacaaacctgacgtggtgctc
ggtatgggaggctacgtgtcaggtccaggtggtctggccgcgtggtcgttaggcattccg
gttgtacttcatgaacaaaacggtattgcgggcttaaccaataaatggctggcgaagatt
gccaccaaagtgatgcaggcgtttccaggtgctttccctaatgcggaagtagtgggtaac
ccggtgcgtaccgatgtgttggcgctgccgttgccgcagcaacgtttggctggacgtgaa
ggtccggttcgtgtgctggtagtgggtggttctcagggcgcacgcattcttaaccagaca
atgccgcaggttgctgcgaaactgggtgattcagtcactatctggcatcagagcggcaaa
ggttcgcaacaatccgttgaacaggcgtatgccgaagcggggcaaccgcagcataaagtg
acggaatttattgatgatatggcggcggcgtatgcgtgggcggatgtcgtcgtttgccgc
tccggtgcgttaacggtgagtgaaatcgccgcggcaggactaccggcgttgtttgtgccg
tttcaacataaagaccgccagcaatactggaatgcgctaccgctggaaaaagcgggcgca
gccaaaattatcgagcagccacagcttagcgtggatgctgtcgccaacaccctggccggg
tggtcgcgagaaaccttattaaccatggcagaacgcgcccgcgctgcatccattccggat
gccaccgagcgagtggcaaatgaagtgagccgggttgcccgggcgtaa
              
                            

Download fasta file
RegulonDB