RegulonDB RegulonDB 10.9: Gene Sequence
emrE gene sequence


Size: 333        A: 76  T: 120  G: 77  C: 60

Fasta

 

>emrE E. coli K12. Version NC_000913.3 GI:556503834
atgaacccttatatttatcttggtggtgcaatacttgcagaggtcattggtacaacctta
atgaagttttcagaaggttttacacggttatggccatctgttggtacaattatttgttat
tgtgcatcattctggttattagctcagacgctggcttatattcctacagggattgcttat
gctatctggtcaggagtcggtattgtcctgattagcttactgtcatggggatttttcggc
caacggctggacctgccagccattataggcatgatgttgatttgtgccggtgtgttgatt
attaatttattgtcacgaagcacaccacattaa
              
                            

Download fasta file
RegulonDB