RegulonDB RegulonDB 10.9: Gene Sequence
nadA gene sequence


Size: 1044        A: 273  T: 247  G: 278  C: 246

Fasta

 

>nadA E. coli K12. Version NC_000913.3 GI:556503834
atgagcgtaatgtttgatccagacacggcgatttatcctttccccccgaagccgacgccg
ttaagcattgatgaaaaagcgtattaccgcgagaagataaaacgtctgctaaaagaacgt
aatgcggtgatggttgcccactactataccgatcccgaaattcaacaactggcagaagaa
accggtggctgtatttctgattctctggaaatggcgcgcttcggtgcaaagcatcccgct
tctactttgttagtcgctggggtgagatttatgggagaaaccgccaaaattctcagtccg
gaaaaaacaattctgatgccgacacttcaggctgaatgttcactggatctcggctgccct
gttgaagaatttaacgcattttgcgatgcccatcccgatcgtactgtcgtcgtctacgcc
aacacttctgctgcggtaaaagcgcgcgcagattgggtggtaacttcaagcattgccgtc
gaacttattgatcatcttgatagtttgggtgaaaaaatcatctgggcacccgacaaacat
ctggggcgttacgtgcaaaaacagacgggtggagacattctatgctggcagggtgcctgt
attgtgcatgatgaatttaagactcaggcgttaacccgcttgcaagaagaatacccggat
gctgccatactggtgcatccagaatcaccacaagctattgtcgatatggcggatgcggtc
ggttccaccagtcaactgatcgctgctgcgaaaacattgccacatcagaggcttattgtg
gcaaccgatcggggtattttctacaaaatgcagcaggcggtgccagataaagagttactg
gaagcaccaaccgcaggtgagggtgcaacctgccgcagctgcgcgcattgtccgtggatg
gccatgaatggccttcaggccatcgcagaggcattagaacaggaaggaagcaatcacgag
gttcatgttgatgaaaggctgcgagagagggcgctggtgccgctcaatcgtatgctggat
tttgcggctacactacgtggataa
              
                            

Download fasta file
RegulonDB