RegulonDB RegulonDB 10.9: Gene Sequence
nagA gene sequence


Size: 1149        A: 289  T: 265  G: 304  C: 291

Fasta

 

>nagA E. coli K12. Version NC_000913.3 GI:556503834
atgtatgcattaacccagggccggatctttaccggccacgaatttcttgatgaccacgcg
gttgttatcgctgatggcctgattaaaagcgtctgtccggtagcggaactgccgccagag
atcgaacaacgttcactgaacggggccattctctcccccggttttatcgatgtgcagtta
aacggctgcggcggcgtacagtttaacgacaccgctgaagcggtcagcgtggaaacgctg
gaaatcatgcagaaagccaatgagaaatcaggctgtactaactatctgccgacgcttatc
accaccagcgatgagctgatgaaacagggcgtgcgcgttatgcgcgagtacctggcaaaa
catccgaatcaggcgttaggtctgcatctggaaggtccgtggctgaatctggtaaaaaaa
ggcacccataatccgaattttgtgcgtaagcctgatgccgcgctggtcgatttcctgtgt
gaaaacgccgacgtcattaccaaagtgaccctggcaccggaaatggttcctgcggaagtc
atcagcaaactggcaaatgccgggattgtggtttctgccggtcactccaacgcgacgttg
aaagaagcaaaagccggtttccgcgcggggattacctttgccacccatctgtacaacgcg
atgccgtatattaccggtcgtgaacctggcctggcgggcgcgatcctcgacgaagctgac
atttattgcggtattattgctgatggcctgcatgttgattacgccaacattcgcaacgct
aaacgtctgaaaggcgacaaactgtgtctggttactgacgccaccgcgccagcaggtgcc
aacattgaacagttcatttttgcgggtaaaacaatatactaccgtaacggactttgtgtg
gatgagaacggtacgttaagcggttcatccttaaccatgattgaaggcgtgcgtaatctg
gtcgaacattgcggtatcgcactggatgaagtgctacgtatggcgacgctctatccggcg
cgtgcgattggcgttgagaaacgtctcggcacactcgccgcaggtaaagtagccaacctg
actgcattcacacctgattttaaaatcaccaagaccatcgttaacggtaacgaggtcgta
actcaataa
              
                            

Download fasta file
RegulonDB