RegulonDB RegulonDB 10.9: Gene Sequence
nagB gene sequence


Size: 801        A: 214  T: 196  G: 192  C: 199

Fasta

 

>nagB E. coli K12. Version NC_000913.3 GI:556503834
atgagactgatccccctgactaccgctgaacaggtcggcaaatgggctgctcgccatatc
gtcaatcgtatcaatgcgttcaaaccgactgccgatcgtccgtttgtactgggcctgccg
actggcggcacgccgatgaccacctataaagcgttagtcgaaatgcataaagcaggccag
gtcagctttaagcacgttgtcaccttcaacatggacgaatatgtcggtctgccgaaagag
catccggaaagctactacagctttatgcaccgtaatttcttcgatcacgttgatattcca
gcagaaaacatcaaccttctcaacggcaacgccccggatatcgacgccgagtgccgccag
tatgaagaaaaaatccgttcttacggaaaaattcatctgtttatgggcggtgtaggtaac
gacggtcatattgcatttaacgaaccggcgtcttctctggcttctcgtactcgtatcaaa
accctgactcatgacactcgcgtcgcaaactctcgtttctttgataacgatgttaatcag
gtgccaaaatatgccctgactgtcggtgttggtacactgctggatgccgaagaagtgatg
attctggtgctgggtagccagaaagcactggcgctgcaggccgccgttgaaggttgcgtg
aaccatatgtggaccatcagctgtctgcaactgcatccgaaagcgatcatggtgtgcgat
gaaccttccaccatggagctgaaagttaagactttaagatatttcaatgaattagaagca
gaaaatatcaaaggtctgtaa
              
                            

Download fasta file
RegulonDB