RegulonDB RegulonDB 10.9: Gene Sequence
umpH gene sequence


Size: 753        A: 165  T: 189  G: 208  C: 191

Fasta

 

>umpH E. coli K12. Version NC_000913.3 GI:556503834
atgaccattaaaaatgtaatttgcgatatcgacggcgtgctgatgcacgataacgtcgcc
gtaccgggtgcagcggaatttttgcacgggattatggataaaggcctgccgctggtgttg
ctgaccaactatccttcgcagactgggcaagatctggcgaaccgctttgccaccgcaggt
gtcgatgtacctgacagcgtgttttatacctctgcgatggcgactgccgatttcctgcgt
cgccaggaaggcaagaaagcgtatgtggtgggcgaaggcgcactgattcatgaactgtac
aaagccggtttcactattaccgatgtgaaccctgatttcgtgattgttggcgaaacgcgt
tcctacaactgggacatgatgcataaagcagcctatttcgtcgctaacggtgcacgtttt
atcgccaccaatccggacacccacgggcgcggtttttatcccgcttgtggcgcgttgtgt
gcagggattgagaaaatctccgggcgcaaaccgttctatgttggtaagcccagcccgtgg
atcatccgcgcagcattaaacaaaatgcaggcgcattcggaagaaacggtgattgtcggc
gataacctgcgtaccgatattctggccggcttccaggcaggtctggagacgattctggtg
ctttctggtgtttcgtcgctcgacgatatcgacagtatgcctttccgccccagctggatt
tacccgtcagtcgctgaaatcgacgttatctga
              
                            

Download fasta file
RegulonDB