RegulonDB RegulonDB 10.9: Gene Sequence
nagC gene sequence


Size: 1221        A: 296  T: 278  G: 322  C: 325

Fasta

 

>nagC E. coli K12. Version NC_000913.3 GI:556503834
atgacaccaggcggacaagctcagataggtaatgttgatctcgtaaaacagcttaacagc
gcggcggtttatcgcctgattgaccagtacgggccaatctcgcggattcagattgccgag
caaagccagcttgcccccgccagcgtaaccaaaattacgcgtcagcttatcgaacgcggg
ctgatcaaagaagttgatcagcaggcctccaccgggggccgccgcgctatctccatcgtc
accgaaacccgcaatttccacgcaatcggcgtacggcttggtcgtcatgacgccaccatc
actctgtttgatctcagcagcaaagtgctggcagaagaacattacccgctgccggaacgt
acccagcaaacgctggaacatgccctgttgaatgccattgctcagtttattgatagctac
cagcgcaaactgcgcgagctgatcgcgatttcggtgatcctgccagggcttgttgacccg
gacagcggcaaaattcattacatgccgcatattcaggtagaaaactgggggctggtagaa
gctctggaagaacgttttaaagtgacctgtttcgttggtcacgatatccgtagtctggcg
ctggcggagcactacttcggtgcaagtcaggattgcgaagactccattctggtgcgtgtc
catcgcggaaccggggccgggattatctctaacgggcgcatttttattggccgcaacggc
aacgtcggtgaaattggccatattcaggtcgaaccgctgggtgaacgctgccactgcggc
aactttggctgcctggaaactatcgctgccaacgctgccattgaacaacgggtgttgaat
ctgttaaagcagggctaccagagccgcgtgccgctggacgactgcaccatcaaaactatc
tgcaaagccgcgaacaaaggcgatagtctggcgtcggaagtaattgagtatgtcggtcgt
catctgggtaaaaccatcgccattgctatcaacttatttaatccgcaaaaaattgttatt
gccggtgaaatcaccgaagccgataaagtgctgctccctgctattgaaagctgcattaat
acccaggcgctgaaggcgtttcgcactaatctgccggtggtacgttctgagctggatcac
cgctcggcaatcggcgcttttgcgctggtaaaacgcgccatgctcaacggtattttgctc
cagcatttgctggaaaattaa
              
                            

Download fasta file
RegulonDB