RegulonDB RegulonDB 10.8: Gene Sequence
nanA gene sequence


Size: 894        A: 217  T: 212  G: 242  C: 223

Fasta

 

>nanA E. coli K12. Version NC_000913.3 GI:556503834
atggcaacgaatttacgtggcgtaatggctgcactcctgactccttttgaccaacaacaa
gcactggataaagcgagtctgcgtcgcctggttcagttcaatattcagcagggcatcgac
ggtttatacgtgggtggttcgaccggcgaggcctttgtacaaagcctttccgagcgtgaa
caggtactggaaatcgtcgccgaagaggcgaaaggtaagattaaactcatcgcccacgtc
ggttgcgtcagcaccgccgaaagccaacaacttgcggcatcggctaaacgttatggcttc
gatgccgtctccgccgtcacgccgttctactatcctttcagctttgaagaacactgcgat
cactatcgggcaattattgattcggcggatggtttgccgatggtggtgtacaacattcca
gccctgagtggggtaaaactgaccctggatcagatcaacacacttgttacattgcctggc
gtaggtgcgctgaaacagacctctggcgatctctatcagatggagcagatccgtcgtgaa
catcctgatcttgtgctctataacggttacgacgaaatcttcgcctctggtctgctggcg
ggcgctgatggtggtatcggcagtacctacaacatcatgggctggcgctatcaggggatc
gttaaggcgctgaaagaaggcgatatccagaccgcgcagaaactgcaaactgaatgcaat
aaagtcattgatttactgatcaaaacgggcgtattccgcggcctgaaaactgtcctccat
tatatggatgtcgtttctgtgccgctgtgccgcaaaccgtttggaccggtagatgaaaaa
tatctgccagaactgaaggcgctggcccagcagttgatgcaagagcgcgggtga
              
                            

Download fasta file
RegulonDB