RegulonDB RegulonDB 10.9: Gene Sequence
narG gene sequence


Size: 3744        A: 905  T: 782  G: 1055  C: 1002

Fasta

 

>narG E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaattcctggaccggtttcgctacttcaaacagaagggtgaaacctttgccgat
gggcatggccagcttctcaataccaaccgtgactgggaggatggatatcgccagcgttgg
cagcatgacaaaatcgtccgctctacccacggggtaaactgcaccggctcctgcagctgg
aaaatctacgtcaaaaacggtctggtcacctgggaaacccagcagactgactatccgcgt
acccgtccggatctgccaaaccatgaacctcgcggctgcccgcgcggtgccagctactcc
tggtatctttacagtgccaaccgcctgaaatacccgatgatgcgcaaacgcctgatgaaa
atgtggcgtgaagcgaaggcgctgcatagcgatccggttgaggcatgggcttctatcatt
gaagacgccgataaagcgaaaagctttaagcaggcgcgtggacgcggtggatttgttcgt
tcttcctggcaggaggtgaacgaactgatcgccgcatctaacgtttacaccatcaaaaac
tacggcccggaccgtgttgctggtttctcgccaattccggcaatgtcgatggtttcttac
gcatcgggtgcacgctatctctcgctgattggcggtacttgcttaagcttctacgactgg
tactgcgacttgcctcctgcgtctccgcaaacctggggcgagcaaactgacgtaccggaa
tctgctgactggtacaactccagctacatcatcgcctgggggtcaaacgtgccgcagacg
cgtaccccggatgctcacttctttactgaagtgcgttacaaagggaccaaaactgttgcc
gtcacaccagactacgctgaaatcgccaaactgtgcgatctgtggctggcaccgaaacag
ggcaccgatgcggcaatggcgctggcgatgggccacgtaatgctgcgtgaattccacctc
gacaacccaagccagtatttcaccgactatgtgcgtcgctacaccgacatgccgatgctg
gtgatgctggaagaacgcgacggttactacgctgcaggtcgtatgctgcgcgctgctgat
ctggttgatgcgctgggccaggaaaacaatccggaatggaaaactgtcgcctttaatacc
aatggcgaaatggttgcgccgaacggttctattggcttccgctggggcgagaagggcaaa
tggaatcttgagcagcgcgacggcaaaactggcgaagaaaccgagctgcaactgagcctg
ctgggtagccaggatgagatcgctgaggtaggcttcccgtactttggtggcgacggcacg
gaacacttcaacaaagtggaactggaaaacgtgctgctgcacaaactgccggtgaaacgc
ctgcaactggctgatggcagcaccgccctggtgaccaccgtttatgatctgacgctggca
aactacggtctggaacgtggcctgaacgacgttaactgtgcaaccagctatgacgatgtg
aaagcttataccccggcctgggccgagcagattaccggcgtttctcgcagccagattatt
cgcatcgcccgtgaatttgccgataacgctgataaaacgcacggtcgttcgatgattatc
gtcggtgcggggctgaaccactggtatcacctcgatatgaactatcgtggtctgatcaac
atgctgattttctgcggctgtgtcggtcagagcgggggcggctgggcgcactatgtaggt
caggaaaaactgcgtccgcaaaccggctggcagccgctggcgtttgcccttgactggcag
cgtccggcgcgtcacatgaacagcacttcttatttctataaccactccagccagtggcgt
tatgaaaccgtcacggcggaagagttgctgtcaccgatggcggacaaatcccgctatacc
ggacacttgatcgactttaacgtccgtgcggaacgcatgggctggctgccgtctgcaccg
cagttaggcactaacccgctgactatcgctggcgaagcggaaaaagccgggatgaatccg
gtggactatacggtgaaatccctgaaagagggttccatccgttttgcggcagaacaacca
gaaaacggtaaaaaccacccgcgcaacctgttcatctggcgttctaacctgctcggttct
tccggtaaaggtcatgagtttatgctcaagtacctgctggggacggagcacggtatccag
ggtaaagatctggggcaacagggcggcgtgaagccggaagaagtggactggcaggacaat
ggtctggaaggcaagctggatctggtggttacgctggacttccgtctgtcgagcacctgt
ctctattccgacatcattttgccgacggcgacctggtacgaaaaagacgacatgaatact
tcggatatgcatccgtttattcacccgctgtctgcggcggtcgatccggcctgggaagcg
aaaagcgactgggaaatctacaaagccatcgcgaagaaattctccgaagtgtgcgtcggc
catctgggtaaagaaaccgacatcgtcacgctgcctatccagcatgactctgccgctgaa
ctggcgcagccgctggatgtgaaagactggaaaaaaggcgagtgcgacctgatcccaggt
aaaaccgcgccacacattatggtcgtagagcgcgattatccggcgacttacgaacgcttt
acctctatcggcccgctgatggagaaaatcggtaatggcggtaaagggattgcctggaac
acccagagcgagatggatctgctgcgtaagctcaactacaccaaagcggaaggtccggcg
aaaggccagccgatgctgaacaccgcaattgatgcggcagagatgatcctgacactggca
ccggaaaccaacggtcaggtagccgtgaaagcctgggctgccctgagcgaatttaccggt
cgtgaccatacgcatctggcgctgaataaagaagacgagaagatccgcttccgcgatatt
caggcacagccgcgcaaaattatctccagcccgacctggtctggtctggaagatgaacac
gtttcttacaacgccggttacaccaacgttcacgagctgatcccatggcgtacgctctct
ggtcgtcagcaactgtatcaggatcaccagtggatgcgtgatttcggtgaaagcctgctg
gtttatcgtccgccgatcgacacccgttcggtgaaagaagtgataggccagaaatccaac
ggcaaccaggaaaaagcgctcaacttcctgacgccgcaccagaagtggggtatccactcc
acctacagcgacaacctgctgatgctgactttaggtcgcggtggtccggtggtctggttg
agtgaagccgatgccaaagatctgggtatcgccgataacgactggattgaagtcttcaac
agcaacggtgctctgactgcccgtgcggttgtcagccagcgtgttccggcagggatgacc
atgatgtaccacgcgcaggaacgtatcgttaacctgcctggttcggaaattacccaacag
cgtggtggtatccataactcggtcacccgtatcacgccgaaaccgacgcatatgatcggc
ggctatgcccatctggcatacggctttaactactatggcaccgtaggttctaaccgcgat
gagtttgttgtagtgcgtaagatgaagaacattgactggttagatggcgaaggcaatgac
caggtacaggagagcgtaaaatga
              
                            

Download fasta file
RegulonDB