RegulonDB RegulonDB 10.9: Gene Sequence
narH gene sequence


Size: 1539        A: 388  T: 324  G: 435  C: 392

Fasta

 

>narH E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattcgttcacaagtcggcatggtgctgaatctcgataagtgcatcggctgccac
acctgttcagttacctgtaaaaacgtctggaccagccgtgaaggcgtggaatatgcgtgg
ttcaacaacgtggaaaccaagccgggccagggcttcccgactgactgggaaaaccaggaa
aaatacaaaggcggctggatccgtaaaatcaacggcaaactgcagccgcgcatgggtaac
cgtgccatgctgctgggtaaaatcttcgctaacccgcatctgccggggatcgacgattat
tacgagccgttcgattttgactatcagaacctgcataccgcgccggaaggcagcaaatcg
cagccgattgcccgtccgcgttcgctgattaccggggaacggatggcgaaaatcgaaaaa
gggccgaactgggaagatgacctgggcggtgagtttgacaaactggcgaaagacaagaac
ttcgacaacatccagaaggcgatgtatagccagttcgaaaacaccttcatgatgtatttg
ccgcgcctgtgcgaacactgcctgaacccggcatgtgtggcgacctgcccgagcggtgcg
atttacaagcgtgaagaagatggcatcgtcctgatcgaccaggataaatgccgtggctgg
cgtatgtgcatcactggatgcccgtacaaaaaaatctacttcaactggaagagcggtaag
tctgagaagtgcatcttctgctatccgcgtattgaagcgggtcagccgaccgtgtgctca
gaaacctgtgtcggtcgtatccgttatcttggcgtgctgttgtacgatgccgacgctatt
gaacgtgcagccagcaccgagaacgagaaagatctttaccagcgtcagctggacgtgttc
ctcgatccgaacgatccgaaagtcatcgagcaggcgattaaagacggtattccgctgagc
gttattgaagccgcacagcagtcgccggtttataaaatggcaatggaatggaaactggcg
ctgccgctgcatccggaatatcgcacactgccgatggtctggtacgtgccgcctctgtct
ccgattcagtctgcagcagacgcgggtgagctgggtagcaacggcattctgccagacgtc
gaaagcctgcgtattccggtacagtatctggcgaatctgctgaccgccggtgataccaaa
ccggtactgcgcgcactgaaacgtatgctggcgatgcgtcattacaaacgtgctgaaacc
gttgacggtaaagttgatacccgtgcgctggaagaggtcggtctgaccgaagcccaggca
caggagatgtaccgttatctggcgattgctaactacgaagatcgctttgtggtgccgagt
agtcatcgtgaactggcacgggaagccttcccggagaaaaatggctgcggctttaccttt
ggtgatggctgccacggttcagataccaaattcaatctgttcaacagccgtcgtatcgat
gccatcgatgtgaccagcaaaacggagccgcatccatga
              
                            

Download fasta file
RegulonDB