RegulonDB RegulonDB 10.8: Gene Sequence
narI gene sequence


Size: 678        A: 116  T: 183  G: 204  C: 175

Fasta

 

>narI E. coli K12. Version NC_000913.3 GI:556503834
atgcaattcctgaatatgttcttctttgatatctacccgtacatagccggggcggtcttc
ctgattggtagctggctgcgttatgactacgggcagtacacctggcgcgcggcgtccagc
cagatgctggatcgcaaagggatgaacctggcgtcgaacctgttccatatcgggattctg
gggatttttgtcggtcacttcttcggtatgctgacgccgcactggatgtatgaagcctgg
ctgccgattgaagtgaaacagaaaatggcaatgtttgctggtggtgccagcggcgtgctg
tgtctgattggcggcgtgctgttgctgaaacgtcgtctgttcagcccacgcgtgcgtgca
accactaccggagcggatatcctgatcctgtcgctgctcgttatccagtgcgcgctgggc
ctgttgaccattccgttctccgctcagcatatggacggtagcgagatgatgaaactggtt
ggctgggcgcagtcggtggtgaccttccacggtggcgcttctcaacacctcgatggtgtg
gcgtttatcttccgtctgcacctggtgctggggatgacgttattcctgctgttcccgttc
tcgcgtctgatacacatctggagcgtaccggtggagtatctgacacgtaagtaccagctg
gtgcgcgctcgtcactaa
              
                            

Download fasta file
RegulonDB