RegulonDB RegulonDB 10.8: Gene Sequence
narJ gene sequence


Size: 711        A: 162  T: 148  G: 211  C: 190

Fasta

 

>narJ E. coli K12. Version NC_000913.3 GI:556503834
atgatcgaactcgtgattgtatcgcgtctccttgaatatccggatgctgccttatggcag
catcaacaagagatgtttgaggcgattgccgcgtcgaaaaatctgccaaaagaggatgcc
catgcgctgggcattttcctgcgcgatttaacgacgatggatccgctcgatgcccaggcg
cagtacagcgaactgttcgaccgtggccgcgccacgtcactgttgctgtttgaacatgtg
cacggcgaatcccgcgaccgcggccaggcgatggtggacctgctggcgcagtacgagcag
cacggcttgcagttaaacagccgcgaattgccggaccatctgccgctgtatctggagtac
ctggcgcagctgccgcaaagcgaagccgtggaaggtttgaaagatatcgcgccgattctg
gcattgctgagcgcgcgtctgcaacagcgtgaaagccgttatgccgtgctgtttgatctg
ctgctgaaactggcgaataccgctatcgacagcgacaaagtggcggaaaaaattgccgac
gaagcgcgcgatgatacgccgcaggcgctggatgctgtctgggaagaagagcaggttaaa
ttctttgctgacaaaggctgcggtgattcagcaatcactgcgcatcagcgtcgctttgcc
ggtgccgtcgcgccgcaatatctgaatatcaccaccggaggacagcactaa
              
                            

Download fasta file
RegulonDB