RegulonDB RegulonDB 10.9: Gene Sequence
narK gene sequence


Size: 1392        A: 243  T: 402  G: 398  C: 349

Fasta

 

>narK E. coli K12. Version NC_000913.3 GI:556503834
atgagtcactcatccgcccccgaaagggctactggagctgtcattacagattggcgaccg
gaagatcctgcgttctggcaacaacgcggtcaacgtattgccagccgcaacctgtggatt
tccgttccctgtctgctgctggcgttttgcgtatggatgttgttcagcgctgttgcggtg
aacctaccgaaagtcggctttaattttacgaccgatcagctatttatgttgactgcgctg
ccttcggtttctggcgcgttattacgtgttccatactcctttatggttcctatcttcggt
ggtcgtcgctggacggcgttcagcaccggtattctgattattccttgcgtctggctgggt
tttgccgtgcaggatacctccacgccttatagcgtcttcatcatcatctctctgctatgc
ggctttgctggcgcgaacttcgcatccagtatggcaaacatcagcttcttctttccgaaa
cagaagcagggtggcgcgctgggtctgaatggtggtctgggaaacatgggcgtcagcgtc
atgcagttggttgctccgctggtggtatcactgtcgattttcgcagtatttggtagccag
ggcgtcaaacagccggatgggactgagctgtatctggcgaatgcgtcctggatatgggtg
ccgttccttgccatcttcaccattgcggcgtggtttggcatgaacgatcttgctacctcg
aaagcctccatcaaggagcagttgccggtactcaaacggggtcatctgtggattatgagc
ctgctgtatctggcaaccttcggctccttcatcggcttctccgcgggctttgcaatgctg
tcaaaaacgcagttcccggatgttcagattctgcaatacgctttcttcgggccgtttatt
ggtgcgctggcgcgttctgcaggtggtgcattatctgaccgtctgggcggaactcgtgtc
acgctggtgaactttattctgatggcgattttcagcggcctgctgttcctgaccttaccg
actgacgggcagggcggaagcttcatggcgttcttcgcggtcttcctggcgctgttcctg
acagctgggctgggtagtggttccactttccagatgatttcagtgatcttccgtaaactg
acaatggatcgcgtgaaagcagaagggggttctgacgaacgtgcgatgcgtgaagcggca
accgacacggcggcggcgctgggtttcatctctgcgattggcgcgattggtggcttcttt
atcccgaaagcgtttggtagctcgctggcattaacgggttcgccagtcggcgcaatgaag
gtatttttgattttctatatcgcctgcgtagtgattacctgggcggtatatggtcggcat
tctaaaaaataa
              
                            

Download fasta file
RegulonDB