RegulonDB RegulonDB 10.9: Gene Sequence
narL gene sequence


Size: 651        A: 173  T: 141  G: 178  C: 159

Fasta

 

>narL E. coli K12. Version NC_000913.3 GI:556503834
atgagtaatcaggaaccggctactatcctgctgattgacgatcacccgatgctgcgaact
ggcgtaaaacagcttatcagtatggcaccagatatcaccgtggttggcgaagcgagtaat
ggcgaacagggtattgaactggcggagtctcttgatcccgatctgatcctgttagatctc
aatatgcccggcatgaacggtctggaaacgctggataaactgcgcgaaaagtccctctca
gggcgcattgtggtattcagcgtctctaaccatgaagaagatgtggtcaccgcactgaaa
cgcggcgcggatggctatctgttaaaagatatggaaccggaagatctgctgaaagcattg
catcaggcagctgctggcgaaatggtattaagcgaagcattaacgcctgttctggccgcc
agcttgcgcgctaaccgtgccactactgagcgcgatgttaaccagttaaccccacgcgag
cgcgatattctcaagctgattgcccagggtttgccgaacaagatgattgcccgccgcctg
gatatcaccgaaagcacagtaaaagtgcacgtcaagcacatgctgaagaaaatgaagctc
aagtctcgcgtggaagcagcggtatgggtgcatcaggagcgcattttctga
              
                            

Download fasta file
RegulonDB