RegulonDB RegulonDB 10.9: Gene Sequence
narZ gene sequence


Size: 3741        A: 897  T: 785  G: 1013  C: 1046

Fasta

 

>narZ E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaacttttggatcgctttcgctacttcaaacaaaagggcgaaacctttgccgat
ggtcacggacaggtgatgcatagcaaccgcgactgggaggacagctatcgccagcgttgg
cagttcgacaaaatcgtgcgttccacccacggtgttaactgtacaggctcctgtagctgg
aaaatctacgttaaaaatggtctggtgacctgggaaatccaacagaccgactacccgcgc
actcgccctgacctgcccaatcatgaacctcgcggctgcccgcgtggcgcaagttactcc
tggtatctttacagcgctaaccgcctgaaatacccgctcattcgtaaacgactgattgaa
ctgtggcgcgaagccctcaagcaacacagcgatccggtactggcgtgggcatcgattatg
aacgatccgcaaaagtgcctgagctacaaacaagtgcgtgggcgcggcgggtttatccgc
tccaactggcaggaactaaaccagctgattgccgccgctaacgtctggaccatcaaaacc
tacggcccggatcgcgttgccggtttctcgccgatcccggcgatgtcgatggtttcttac
gccgccggaacgcgttatctgtcgctgcttggcggcacctgtttaagtttctacgactgg
tattgcgacctgccgcccgcctcgccgatgacctggggcgagcaaaccgacgtaccggaa
tctgccgactggtataactccagctacatcatcgcctgggggtctaacgtaccgcagaca
cgtacgccggacgcccacttctttaccgaagtacgctacaaaggcactaaaaccatcgcc
attacccctgactactctgaagtggccaaattgtgcgaccagtggctggcaccgaaacaa
ggcactgatagcgccctggcgatggcaatgggccatgtgattttaaaagagtttcatctc
gataatcccagcgactactttatcaactactgccgccgctacagcgacatgccgatgctg
gtaatgctggagcctcgcgacgatggtagctacgttcccgggcgcatgatccgcgcatct
gacctggtggatggactgggcgaaagcaacaatccgcagtggaaaaccgtagcagttaat
accgcaggtgaattggtagtgccgaacggttcgattggtttccgctggggagaaaaaggc
aaatggaatctggaatccattgccgccggtacggaaaccgaattgtcgttaaccctgctc
ggtcaacatgacgctgttgcaggcgtggccttcccctactttggcggcattgaaaatccg
cattttcgcagcgtaaaacacaatccggtgctggtgcgccaattgcccgttaaaaacctg
acgttagtcgatggcaacacctgtccggtggtcagcgtttatgatttggtactggcgaat
tacggcctcgatcgcgggctggaagatgaaaacagtgcgaaagattacgctgaaatcaaa
ccgtacaccccagcctggggtgagcaaattaccggcgtgccgcgccagtatattgaaacc
atcgcccgtgaatttgccgataccgcccataaaacgcatgggcgctcgatgattatcctc
ggcgcaggtgttaaccactggtatcacatggacatgaactaccgcgggatgatcaatatg
ctgatcttctgcggttgtgtcgggcaaagcggtggcggctgggcacactatgtcggccag
gaaaaactgcgcccacaaaccggctggttgccactggcctttgcgctcgactggaaccga
ccaccgcgccaaatgaacagcacctcgtttttctacaatcattccagccaatggcgctat
gaaaaagtctctgctcaggagttactttcaccgctcgccgatgccagtaagtacagcggt
catctgattgatttcaacgttcgcgccgaacgtatgggctggctaccttctgcgccgcag
ctggggcgtaacccgctcgggattaaagctgaagccgacaaggccggattatcccccaca
gaatttaccgcccaggcgctgaaatcgggcgatttacgtatggcctgcgaacaaccagat
agcagcagcaatcatccgcgtaatttgtttgtctggcgctctaacctgcttggctcctcc
ggcaaaggccacgagtatatgcagaagtatctgctggggaccgaaagcgggattcagggc
gaggaactcggtgccagcgacgggatcaaaccggaagaagtcgagtggcaaactgcagcg
attgaaggcaagctcgacctgctggtgacgctcgacttccgcatgtccagtacctgcctg
ttctccgatatcgttctgcccaccgccacctggtacgaaaaagacgatatgaacacctcg
gatatgcatccgtttattcatccgctttctgcggcggtcgatccggcgtgggaatcacgc
agcgactgggaaatctacaaaggtatcgccaaagcattttcgcaagtgtgcgtgggtcat
cttggcaaagaaaccgacgtggtattacaacccctactgcatgactctccggcagagctc
tcacagccgtgtgaagtgctcgactggcgcaaaggcgaatgcgatctgattccaggcaaa
accgcgccgaatattgtggcggtggagcgcgactaccctgctacgtatgaacgctttacc
tcgctcgggccattgatggacaaacttggcaatggcggtaaagggatttcgtggaatacc
caggatgaaatcgatttcctcggcaaactcaattacaccaagcgtgatggcccggcacag
gggcgtccgctgattgacaccgccattgacgcttcagaagtgattctggcactggcaccg
gaaaccaacggtcatgttgcagtcaaagcgtggcaggcgctgggcgagatcaccgggcgc
gaacatacccatctggcgctgcacaaagaggacgagaagattcgctttcgcgatattcag
gcgcagccgcgtaaaattatctccagccccacctggtccggtctggaaagcgatcacgtc
tcctataacgcgggatacaccaacgttcatgagttaattccgtggcgcacgctgtcggga
cgccagcagctctatcaggatcatccgtggatgcgtgcttttggtgaaagcctggtggct
tatcgcccgcctatcgacacccgtagcgtcagtgagatgcgccagataccgccaaacggc
ttcccggaaaaagcacttaacttcctgacgccgcaccagaaatggggcattcactcaacc
tacagtgaaaacctgctaatgctgacgctctctcgcggtggaccgattgtctggatcagc
gaaacagatgcccgagaactgaccattgtcgataacgactgggtggaagtattcaacgcc
aacggcgcgctgactgcccgcgcggtggtcagccaacgtgtaccgccgggcatgaccatg
atgtatcacgcccaggaacgcattatgaatattcctggttcggaagtaactggcatgcgc
ggcggcattcataactcggttacccgcgtttgcccgaaaccaacgcatatgattggcggt
tacgcgcagctggcctggggctttaactactacggcaccgtcggatcgaaccgcgatgag
ttcatcatgatccgcaagatgaagaacgttaactggctggatgatgaaggtcgcgatcag
gtacaggaggcgaaaaaatga
              
                            

Download fasta file
RegulonDB