RegulonDB RegulonDB 10.9: Gene Sequence
ndh gene sequence


Size: 1305        A: 326  T: 288  G: 363  C: 328

Fasta

 

>ndh E. coli K12. Version NC_000913.3 GI:556503834
ttgactacgccattgaaaaagattgtgattgtcggcggcggtgctggtgggctggaaatg
gcaacacagctggggcataagctgggacgcaagaaaaaagccaaaattacgctggtcgat
cgtaaccacagccacctgtggaaaccgctgctgcacgaagtggcgactggctcgcttgat
gaaggcgtcgatgcgttgagctatctggcccatgcgcgcaatcatggtttccagttccag
ctgggttccgtcattgatattgatcgtgaagcgaaaacaatcactattgcagaactgcgc
gacgagaaaggtgaactgctggttccggaacgtaaaatcgcctatgacaccctggtaatg
gcgctgggtagcacctctaacgatttcaatacgccaggtgtcaaagagaactgcattttc
ctcgataacccgcaccaggcgcgtcgcttccaccaggagatgctgaatttgttcctgaaa
tactccgccaacctgggcgcgaatggcaaagtgaacattgcgattgtcggcggcggcgcg
acgggtgtagaactctccgctgaattgcacaacgcggtcaagcaactgcacagctacggt
tacaaaggcctgaccaacgaagccctgaacgtaacgctggtagaagcgggagaacgtatt
ttgcctgcgttaccgccacgtatctctgctgcggcccacaacgagctaacgaaacttggc
gttcgcgtgctgacgcaaaccatggtcaccagtgctgatgaaggcggcctgcacactaaa
gatggcgaatatattgaggctgatctgatggtatgggcagccgggatcaaagcgccagac
ttcctgaaagatatcggtggtcttgaaactaaccgtatcaaccagctggtggtggaaccg
acgctgcaaaccacccgcgatccagacatttacgctattggcgactgcgcgtcatgcccg
cgtccggaagggggctttgttccgccgcgtgctcaggctgcacaccagatggcgacttgc
gcaatgaacaacattctggcgcagatgaacggtaagccgctgaaaaattatcagtataaa
gatcatggttcgctggtatcgctgtcgaacttctccaccgtcggtagcctgatgggtaac
ctgacgcgcggctcaatgatgattgaaggacgaattgcgcgctttgtatatatctcgcta
taccgaatgcatcagattgcgctgcatggttactttaaaaccggattaatgatgctggtg
gggagtattaaccgcgttatccgtccgcgtttgaagttgcattaa
              
                            

Download fasta file
RegulonDB