RegulonDB RegulonDB 10.9: Gene Sequence
ndk gene sequence


Size: 432        A: 98  T: 108  G: 112  C: 114

Fasta

 

>ndk E. coli K12. Version NC_000913.3 GI:556503834
atggctattgaacgtactttttccatcatcaaaccgaacgcggtagcaaaaaacgtcatt
ggtaatatctttgcgcgctttgaagctgcagggttcaaaattgttggcaccaaaatgctg
cacctgaccgttgaacaggcacgtggcttttatgctgaacacgatggaaaaccgttcttt
gatggtctggttgaattcatgacctctggcccgatcgtggtttccgtgctggaaggtgaa
aacgccgttcagcgtcaccgcgatctgctgggcgcgaccaatccggcaaacgcactggct
ggtactctgcgcgctgattacgctgacagcctgaccgaaaacggtacccacggttctgat
tccgtcgaatctgccgctcgcgaaatcgcttatttctttggcgaaggcgaagtgtgcccg
cgcacccgttaa
              
                            

Download fasta file
RegulonDB