RegulonDB RegulonDB 10.10: Gene Sequence
nirD gene sequence


Size: 327        A: 77  T: 67  G: 98  C: 85

Fasta

 

>nirD E. coli K12. Version NC_000913.3 GI:556503834
atgagccagtggaaagacatctgcaaaatcgatgacatcctgcctgaaaccggcgtctgc
gcgctgttaggtgacgagcaggtcgcgattttccgcccgtatcacagcgatcaggtgttt
gcgatcagcaacatcgacccgttcttcgagtccagcgtgctgtcacgcggactgattgcg
gaacaccagggcgagctgtgggtcgccagcccgctgaaaaaacagcgttttcgcttaagc
gacggcttgtgcatggaagacgaacagttttccgtcaaacattacgaagcgcgagtgaaa
gacggcgtggtgcagctgcgcggttaa
              
                            

Download fasta file
RegulonDB