RegulonDB RegulonDB 10.9: Gene Sequence
bamC gene sequence


Size: 1035        A: 231  T: 230  G: 303  C: 271

Fasta

 

>bamC E. coli K12. Version NC_000913.3 GI:556503834
atggcttactctgttcaaaagtcgcgcctggcaaaggttgcgggtgtttcgcttgtttta
ttactcgctgcctgtagttctgactcacgctataagcgtcaggtcagtggtgatgaagcc
tacctggaagcggcaccgcttgcggagcttcatgccccggctggaatgattttgccggtg
acctccggtgattatgcaatcccggtgaccaacggtagtggtgctgtcggtaaggcgctg
gacattcgtccaccagcccagccgctggcactggtttctggcgcgcgtacccagttcacg
ggcgataccgcttcattgctggtggaaaatggtcgtggcaatactctgtggccgcaggtg
gttagcgtgctgcaggcgaaaaactacaccatcacccaacgtgatgatgctggtcagaca
ctgaccaccgattgggtacaatggaaccgtctggacgaagacgagcagtatcgtggtcgt
tatcaaatctctgttaagccgcagggttatcagcaggcggttacggttaaactgctgaac
ctggaacaggcgggcaaaccggttgcagacgcggcttccatgcagcgttacagcacggag
atgatgaacgttatttccgccggtctggataaatctgccactgacgccgcgaacgctgcg
caaaatcgtgcctccaccactatggacgtacaaagtgcagctgatgacaccggtttacca
atgctggtcgtacgcgggccgttcaatgtggtttggcaacgtctgccagcggcgctggaa
aaagtgggcatgaaagtgaccgacagcacccgttcgcagggcaacatggccgtaacttat
aagccgctgtctgacagcgactggcaggaactgggcgcgagcgatccaggcctggcatcc
ggtgactataaactgcaggttggcgatttagataaccgcagcagcctacagttcatcgat
ccgaaaggtcatactctgactcagagtcagaacgacgcgctggtagctgtcttccaggct
gcgtttagcaagtaa
              
                            

Download fasta file
RegulonDB