RegulonDB RegulonDB 11.1: Gene Sequence
nrdA gene sequence


Size: 2286        A: 555  T: 504  G: 605  C: 622

Fasta

 

>nrdA E. coli K12. Version NC_000913.3 GI:556503834
atgaatcagaatctgctggtgacaaagcgcgacggtagcacagagcgcatcaatctcgac
aaaatccatcgcgttctggattgggcggcagaaggactgcataacgtttcgatttcccag
gtcgagctgcgctcccacattcagttttatgacggtatcaagacctctgacatccacgaa
accattatcaaggctgccgcagacctgatctcccgtgatgcgccggattatcagtatctc
gccgcgcgcctggcgatcttccacctgcgtaaaaaagcctacggccagtttgagccgcct
gcgctgtacgaccacgtggtgaaaatggtcgagatgggcaaatacgataatcatctgctg
gaagactacacggaagaagagttcaagcagatggacacctttatcgatcacgaccgtgat
atgaccttctcttatgctgccgttaagcagctggaaggcaaatatctggtacagaaccgc
gtgaccggcgaaatctatgagagcgcccagttcctttatattctagttgccgcgtgcttg
ttctcgaactacccgcgtgaaacgcgcctgcaatatgtgaagcgtttttacgacgcggtt
tccacatttaaaatttcgctgccgacgccaatcatgtccggcgtgcgtaccccgactcgt
cagttcagctcctgcgtactgatcgagtgcggtgacagcctggattccatcaacgccacc
tccagcgcgattgttaaatacgtttcccagcgtgccgggatcggcatcaacgccgggcgt
attcgtgcgctgggtagcccgattcgcggtggtgaagcgttccataccggctgcattccg
ttctacaaacatttccagacagcggtgaaatcctgctctcagggcggtgtgcgcggcggt
gcggcaacgctgttctacccgatgtggcatctggaagtggaaagcctgctggtgttgaaa
aacaaccgtggtgtggaaggcaaccgcgtgcgtcatatggactacggggtacaaatcaac
aaactgatgtatacccgtctgctgaaaggtgaagatatcaccctgttcagcccgtccgac
gtaccggggctgtacgacgcgttcttcgccgatcaggaagagtttgaacgtctgtatacc
aaatatgagaaagacgacagcatccgcaagcagcgtgtgaaagccgttgagctgttctcg
ctgatgatgcaggaacgtgcgtctaccggtcgtatctatattcagaacgttgaccactgc
aatacccatagcccgtttgatccggccatcgcgccagtgcgtcagtctaacctgtgcctg
gagatagccctgccgaccaaaccgctgaacgacgtcaacgacgagaacggtgaaatcgcg
ctgtgtacgctgtctgctttcaacctgggcgcaattaataacctggatgaactggaagag
ctggcaattctggcggttcgtgcacttgacgcgctgctggattatcaggattacccgatc
ccggccgccaaacgtggagcgatgggtcgtcgtacgctgggtattggtgtgatcaacttc
gcttactacctggcgaagcacggtaaacgctactccgacggcagcgccaacaacctgacg
cataaaaccttcgaagccattcagtattacctgctgaaagcctctaatgagctggcgaaa
gagcaaggcgcgtgcccgtggtttaacgaaaccacttacgcgaaagggatcctgccgatc
gatacctataagaaagatctggataccatcgctaatgagccgctgcattacgactgggaa
gctctgcgtgagtcaatcaaaacgcacggtctgcgtaactccacgctttctgctctgatg
ccgtccgagacttcttcgcagatctctaacgccactaacggtattgaaccgccgcgcggt
tacgtcagcatcaaagcgtcgaaagacggtattttgcgccaggtggtgccggactacgag
cacctgcacgacgcctatgagctgctgtgggaaatgccgggtaacgatggttatctgcaa
ctggtgggtatcatgcagaaatttatcgatcagtcgatctctgccaacaccaactacgat
ccgtcacgcttcccgtcaggaaaagtgccgatgcagcagttgctgaaagacctgctcacc
gcctacaaattcggggtcaaaacactgtattatcagaacacccgtgacggcgctgaagac
gcacaagacgatctggtgccgtcaatccaggacgatggctgcgaaagcggcgcatgtaag
atctga
              
                            

Download fasta file
RegulonDB