RegulonDB RegulonDB 10.8: Gene Sequence
nusA gene sequence


Size: 1488        A: 387  T: 316  G: 433  C: 352

Fasta

 

>nusA E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaagaaattttggctgtagttgaagccgtatccaatgaaaaggcgctacctcgc
gagaagattttcgaagcattggaaagcgcgctggcgacagcaacaaagaaaaaatatgaa
caagagatcgacgtccgcgtacagatcgatcgcaaaagcggtgattttgacactttccgt
cgctggttagttgttgatgaagtcacccagccgaccaaggaaatcacccttgaagccgca
cgttatgaagatgaaagcctgaacctgggcgattacgttgaagatcagattgagtctgtt
acctttgaccgtatcactacccagacggcaaaacaggttatcgtgcagaaagtgcgtgaa
gccgaacgtgcgatggtggttgatcagttccgtgaacacgaaggtgaaatcatcaccggc
gtggtgaaaaaagtaaaccgcgacaacatctctctggatctgggcaacaacgctgaagcc
gtgatcctgcgcgaagatatgctgccgcgtgaaaacttccgccctggcgaccgcgttcgt
ggcgtgctctattccgttcgcccggaagcgcgtggcgcgcaactgttcgtcactcgttcc
aagccggaaatgctgatcgaactgttccgtattgaagtgccagaaatcggcgaagaagtg
attgaaattaaagcagcggctcgcgatccgggttctcgtgcgaaaatcgcggtgaaaacc
aacgataaacgtatcgatccggtaggtgcttgcgtaggtatgcgtggcgcgcgtgttcag
gcggtgtctactgaactgggtggcgagcgtatcgatatcgtcctgtgggatgataacccg
gcgcagttcgtgattaacgcaatggcaccggcagacgttgcttctatcgtggtggatgaa
gataaacacaccatggatatcgccgttgaagccggtaacctggcgcaggcgattggccgt
aacggtcagaacgtgcgtctggcttcgcagctgagcggttgggaactcaacgtgatgacc
gttgacgacctgcaggctaagcatcaggcggaagcgcacgcagcgatcgacaccttcacc
aaatatctcgacatcgacgaagacttcgcgactgttctggtagaagaaggcttctcgacg
ctggaagaattggcctatgtgccgatgaaagagctgttggaaatcgaaggccttgatgag
ccgaccgttgaagcactgcgcgagcgtgctaaaaatgcactggccaccattgcacaggcc
caggaagaaagcctcggtgataacaaaccggctgacgatctgctgaaccttgaaggggta
gatcgtgatttggcattcaaactggccgcccgtggcgtttgtacgctggaagatctcgcc
gaacagggcattgatgatctggctgatatcgaagggttgaccgacgaaaaagccggagca
ctgattatggctgcccgtaatatttgctggttcggtgacgaagcgtaa
              
                            

Download fasta file
RegulonDB