RegulonDB RegulonDB 10.9: Gene Sequence
ogt gene sequence


Size: 516        A: 122  T: 120  G: 149  C: 125

Fasta

 

>ogt E. coli K12. Version NC_000913.3 GI:556503834
atgctgagattacttgaagaaaaaattgccacgccactgggtccactgtgggtgatttgc
gatgagcaatttcgcctgcgggcggttgaatgggaagagtacagcgaacgcatggtgcag
ctgctggacatccattatcgcaaagaaggctatgagcgcatttctgccaccaatccaggc
ggtttaagcgacaagcttcgtgaatattttgccggtaatcttagcattattgatacgctt
cccactgctacgggggggacgccatttcagcgcgaagtctggaaaacactacgcactatc
ccctgcgggcaggtaatgcattacggccaactggctgagcaattgggccgtcctggcgcg
gcgcgtgccgttggtgcggcaaacggatcgaatcccatcagcatcgtcgtaccttgccat
cgggttattggccgaaacggcaccatgaccggatatgcaggcggagttcagcgaaaagag
tggttattgcgccatgaaggttatcttttgctgtaa
              
                            

Download fasta file
RegulonDB