RegulonDB RegulonDB 10.9: Gene Sequence
ompC gene sequence


Size: 1104        A: 285  T: 260  G: 271  C: 288

Fasta

 

>ompC E. coli K12. Version NC_000913.3 GI:556503834
atgaaagttaaagtactgtccctcctggtcccagctctgctggtagcaggcgcagcaaac
gctgctgaagtttacaacaaagacggcaacaaattagatctgtacggtaaagtagacggc
ctgcactatttctctgacaacaaagatgtagatggcgaccagacctacatgcgtcttggc
ttcaaaggtgaaactcaggttactgaccagctgaccggttacggccagtgggaatatcag
atccagggcaacagcgctgaaaacgaaaacaactcctggacccgtgtggcattcgcaggt
ctgaaattccaggatgtgggttctttcgactacggtcgtaactacggcgttgtttatgac
gtaacttcctggaccgacgtactgccagaattcggtggtgacacctacggttctgacaac
ttcatgcagcagcgtggtaacggcttcgcgacctaccgtaacactgacttcttcggtctg
gttgacggcctgaactttgctgttcagtaccagggtaaaaacggcaacccatctggtgaa
ggctttactagtggcgtaactaacaacggtcgtgacgcactgcgtcaaaacggcgacggc
gtcggcggttctatcacttatgattacgaaggtttcggtatcggtggtgcgatctccagc
tccaaacgtactgatgctcagaacaccgctgcttacatcggtaacggcgaccgtgctgaa
acctacactggtggtctgaaatacgacgctaacaacatctacctggctgctcagtacacc
cagacctacaacgcaactcgcgtaggttccctgggttgggcgaacaaagcacagaacttc
gaagctgttgctcagtaccagttcgacttcggtctgcgtccgtccctggcttacctgcag
tctaaaggtaaaaacctgggtcgtggctacgacgacgaagatatcctgaaatatgttgat
gttggtgctacctactacttcaacaaaaacatgtccacctacgttgactacaaaatcaac
ctgctggacgacaaccagttcactcgtgacgctggcatcaacactgataacatcgtagct
ctgggtctggtttaccagttctaa
              
                            

Download fasta file
RegulonDB