RegulonDB RegulonDB 10.9: Gene Sequence
ompF gene sequence


Size: 1089        A: 288  T: 281  G: 269  C: 251

Fasta

 

>ompF E. coli K12. Version NC_000913.3 GI:556503834
atgatgaagcgcaatattctggcagtgatcgtccctgctctgttagtagcaggtactgca
aacgctgcagaaatctataacaaagatggcaacaaagtagatctgtacggtaaagctgtt
ggtctgcattatttttccaagggtaacggtgaaaacagttacggtggcaatggcgacatg
acctatgcccgtcttggttttaaaggggaaactcaaatcaattccgatctgaccggttat
ggtcagtgggaatataacttccagggtaacaactctgaaggcgctgacgctcaaactggt
aacaaaacgcgtctggcattcgcgggtcttaaatacgctgacgttggttctttcgattac
ggccgtaactacggtgtggtttatgatgcactgggttacaccgatatgctgccagaattt
ggtggtgatactgcatacagcgatgacttcttcgttggtcgtgttggcggcgttgctacc
tatcgtaactccaacttctttggtctggttgatggcctgaacttcgctgttcagtacctg
ggtaaaaacgagcgtgacactgcacgccgttctaacggcgacggtgttggcggttctatc
agctacgaatacgaaggctttggtatcgttggtgcttatggtgcagctgaccgtaccaac
ctgcaagaagctcaacctcttggcaacggtaaaaaagctgaacagtgggctactggtctg
aagtacgacgcgaacaacatctacctggcagcgaactacggtgaaacccgtaacgctacg
ccgatcactaataaatttacaaacaccagcggcttcgccaacaaaacgcaagacgttctg
ttagttgcgcaataccagttcgatttcggtctgcgtccgtccatcgcttacaccaaatct
aaagcgaaagacgtagaaggtatcggtgatgttgatctggtgaactactttgaagtgggc
gcaacctactacttcaacaaaaacatgtccacctatgttgactacatcatcaaccagatc
gattctgacaacaaactgggcgtaggttcagacgacaccgttgctgtgggtatcgtttac
cagttctaa
              
                            

Download fasta file
RegulonDB