RegulonDB RegulonDB 10.9: Gene Sequence
ompT gene sequence


Size: 954        A: 302  T: 238  G: 213  C: 201

Fasta

 

>ompT E. coli K12. Version NC_000913.3 GI:556503834
atgcgggcgaaacttctgggaatagtcctgacaacccctattgcgatcagctcttttgct
tctaccgagactttatcgtttactcctgacaacataaatgcggacattagtcttggaact
ctgagcggaaaaacaaaagagcgtgtttatctagccgaagaaggaggccgaaaagtcagt
caactcgactggaaattcaataacgctgcaattattaaaggtgcaattaattgggatttg
atgccccagatatctatcggggctgctggctggacaactctcggcagccgaggtggcaat
atggtcgatcaggactggatggattccagtaaccccggaacctggacggatgaaagtaga
caccctgatacacaactcaattatgccaacgaatttgatctgaatatcaaaggctggctc
ctcaacgaacccaattaccgcctgggactcatggccggatatcaggaaagccgttatagc
tttacagccagaggtggttcctatatctacagttctgaggagggattcagagatgatatc
ggctccttcccgaatggagaaagagcaatcggctacaaacaacgttttaaaatgccctac
attggcttgactggaagttatcgttatgaagattttgaactcggtggcacatttaaatac
agcggctgggtggaatcatctgataacgatgaacactatgacccgggaaaaagaatcact
tatcgcagtaaggtcaaagaccaaaattactattctgttgcagtcaatgcaggttattac
gtcacacctaacgcaaaagtttatgttgaaggcgcatggaatcgggttacgaataaaaaa
ggtaatacttcactttatgatcacaataataacacttcagactacagcaaaaatggagca
ggtatagaaaactataacttcatcactactgctggtcttaagtacacattttaa
              
                            

Download fasta file
RegulonDB