RegulonDB RegulonDB 10.9: Gene Sequence
oppD gene sequence


Size: 1014        A: 244  T: 245  G: 283  C: 242

Fasta

 

>oppD E. coli K12. Version NC_000913.3 GI:556503834
atgagcgtaattgaaactgcaactgtgccgctcgcacaacaacaggctgacgcactgctg
aacgtgaaagatttgcgtgtcacctttagtaccccggacggcgacgtcacggcggtcaat
gatttgaatttttccctacgtgccggagaaacgctgggtattgtaggtgagtctggttcg
ggtaaatcgcaaactgcatttgcgttgatgggcctgttggctgccaacggacgtattggc
ggatcggcaaccttcaatgggcgtgaaatcctcaatttgccagagcatgaactcaataaa
ctgcgcgctgaacaaatctcaatgatttttcaggacccaatgacttcgttgaatccctat
atgcgcgtcggtgagcagttgatggaagtgctgatgctgcataagaacatgagcaaagct
gaggcgtttgaagagtcggtgcggatgctcgatgcggtaaaaatgccggaagcgcgtaaa
cgcatgaaaatgtacccgcacgaattttctggcggcatgcgtcagcgagtcatgattgcg
atggccttgttatgtcgacctaagctgctgattgcggatgaaccaacaactgcgctggac
gtcaccgtacaggcgcagatcatgacgctattaaatgaactgaagcgggaatttaatacc
gccatcattatgatcacccacgatcttgtcgtggtggcggggatctgcgacaaagtgctg
gtaatgtacgccgggcgcacgatggaatatggcaacgcgcgcgatgtcttttatcaaccc
gttcatccttattctatcggtttgctcaacgcggtgccgcgtctcgatgcggaaggtgaa
acaatgttgaccatcccgggtaatccgccaaacctgctgcgattaccgaaaggttgcccg
ttccagccacgttgtccgcatgcgatggaaatttgtagtagcgcaccgccgctggaagag
tttacgcctggccgtctgcgtgcttgctttaaaccggtggaggaactgttatga
              
                            

Download fasta file
RegulonDB