RegulonDB RegulonDB 10.9: Gene Sequence
pabA gene sequence


Size: 564        A: 127  T: 136  G: 153  C: 148

Fasta

 

>pabA E. coli K12. Version NC_000913.3 GI:556503834
atgatcctgcttatagataactacgattcttttacctggaacctctaccagtacttttgt
gaactgggggcggatgtgctggttaagcgcaacgatgcgttgacgctggcggatatcgac
gcccttaaaccacaaaaaattgtcatctcacctggcccctgtacgccagatgaagccggg
atctcccttgacgttattcgccactatgccgggcgcttgccgattcttggcgtctgcctc
ggtcatcaggcaatggcgcaggcatttggcggtaaagttgtgcgcgccgcaaaggtcatg
cacggcaaaacctcgccgattacacataacggtgagggcgtatttcgggggctggcaaat
ccacttaccgtgacacgctaccattcgctggtggtggaacctgactcattaccagcgtgc
tttgacgtgacggcctggagcgaaacccgagagattatggggattcgccatcgccagtgg
gatctggaaggtgtgcagttccatccagaaagtattcttagcgaacaaggacatcaactg
ctggctaatttcctgcatcgctga
              
                            

Download fasta file
RegulonDB