RegulonDB RegulonDB 10.9: Gene Sequence
pabB gene sequence


Size: 1362        A: 334  T: 334  G: 346  C: 348

Fasta

 

>pabB E. coli K12. Version NC_000913.3 GI:556503834
atgaagacgttatctcccgctgtgattactttactctggcgtcaggacgccgctgaattt
tatttctcccgcttaagccacctgccgtgggcgatgcttttacactccggctatgccgat
catccgtatagccgctttgatattgtggtcgccgagccgatttgcactttaaccactttc
ggtaaagaaaccgttgttagtgaaagcgaaaaacgcacaacgaccactgatgacccgcta
caggtgctccagcaggtgctggatcgcgcagacattcgcccaacgcataacgaagatttg
ccatttcagggcggcgcactggggttgtttggctacgatctgggccgccgttttgagtca
ctgccagaaattgcggaacaagatatcgttctgccggatatggcagtgggtatctacgat
tgggcgctcattgtcgaccaccagcgtcatacagtttctttgctgagtcataatgatgtc
aatgcccgtcgggcctggctggaaagccagcaattctcgccgcaggaagatttcacgctc
acttccgactggcaatccaatatgacccgcgagcagtacggcgaaaaatttcgccaggta
caggaatatctgcacagcggtgattgctatcaggtgaatctcgcccaacgttttcatgcg
acctattctggcgatgaatggcaggcattccttcagcttaatcaggccaaccgcgcgcca
tttagcgcttttttacgtcttgaacagggtgcaattttaagcctttcgccagagcggttt
attctttgtgataatagtgaaatccagacccgcccgattaaaggcacgctaccacgcctg
cccgatcctcaggaagatagcaaacaagcagtaaaactggcgaactcagcgaaagatcgt
gccgaaaatctgatgattgtcgatttaatgcgtaatgatatcggtcgtgttgccgtagca
ggttcggtaaaagtaccagagctgttcgtggtggaacccttccctgccgtgcatcatctg
gtcagcaccataacggcgcaactaccagaacagttacacgccagcgatctgctgcgcgca
gcttttcctggtggctcaataaccggggctccgaaagtacgggctatggaaattatcgac
gaactggaaccgcagcgacgcaatgcctggtgcggcagcattggctatttgagcttttgc
ggcaacatggataccagtattactatccgcacgctgactgccattaacggacaaattttc
tgctctgcgggcggtggaattgtcgccgatagccaggaagaagcggaatatcaggaaact
tttgataaagttaatcgtatcctgaagcaactggagaagtaa
              
                            

Download fasta file
RegulonDB