RegulonDB RegulonDB 10.9: Gene Sequence
pal gene sequence


Size: 522        A: 141  T: 113  G: 136  C: 132

Fasta

 

>pal E. coli K12. Version NC_000913.3 GI:556503834
atgcaactgaacaaagtgctgaaagggctgatgattgctctgcctgttatggcaattgcg
gcatgttcttccaacaagaacgccagcaatgacggcagcgaaggcatgctgggtgccggc
actggtatggatgcgaacggcggcaacggcaacatgtcttccgaagagcaggctcgtctg
caaatgcaacagctgcagcagaacaacatcgtttacttcgatctggacaagtacgatatc
cgttctgacttcgctcaaatgctggatgcacatgcaaacttcctgcgtagcaacccgtct
tacaaagtcaccgtagaaggtcacgcggacgaacgtggtactccggaatacaacatctcc
ctgggtgaacgtcgtgcgaacgccgttaagatgtacctgcagggtaaaggcgtttctgca
gaccagatctccatcgtttcttacggtaaagaaaaacctgcagtactgggtcatgacgaa
gcggcatactccaaaaaccgtcgtgcggtactggtttactaa
              
                            

Download fasta file
RegulonDB