RegulonDB RegulonDB 10.9: Gene Sequence
panF gene sequence


Size: 1452        A: 264  T: 399  G: 418  C: 371

Fasta

 

>panF E. coli K12. Version NC_000913.3 GI:556503834
atgcagcttgaagtaattctaccgctggtcgcctatctggtggtggtgttcggtatctcg
gtttatgcgatgcgtaaacggagcaccggcaccttccttaatgagtatttcctcggcagc
cgctctatgggcggtattgtgctggcgatgacgctcaccgcgacctatatcagtgccagt
tcgtttatcggcgggccaggagctgcttataaatacgggctgggctgggtattgctggcg
atgattcagcttcctgcagtctggctttcactcggtattctcggcaagaagtttgcgatt
cttgcgcgccgctacaatgcagtgacgctgaacgatatgctgtttgcccgctaccagagt
cgtcttctggtgtggctggcgagtttgagtttgctggttgcgttcgttggtgcgatgacc
gtgcagtttatcggcggtgcgcgcctgctggaaaccgcggcgggtattccttatgaaacc
gggctgctgatttttggtatcagcattgcgttatataccgcctttggtggctttcgcgcc
agcgtgctgaacgacaccatgcaagggcttgtgatgctgattggcaccgttgtgctgctt
attggcgtagtacatgccgctggcggcttaagtaacgcagtacagaccttgcaaaccatc
gatccgcaactggttacgccacaaggcgctgacgatattctgtcgcctgcctttatgacg
tcgttctgggtactggtgtgttttggcgtgattggcctgccgcatactgcggtgcgctgt
atctcttataaagacagcaaagccgtacatcgggggatcatcatcggtacgattgtggtc
gcaattctgatgttcggtatgcacctggccggagcgttaggtcgggcggtgatccccgat
ctcaccgtaccggacctggtgatcccaacgttaatggtaaaagtgctgccaccgtttgct
gccgggatcttcctggctgcaccgatggctgcgatcatgtcgacaattaacgcccaactg
ctgcaaagttccgctacgatcattaaagatctctatctgaatatccgtccggatcaaatg
caaaacgagacgcgtctgaagcggatgtcggcggtaattacgttagttctcggcgcgttg
ctgctgcttgccgcctggaagccgccagaaatgatcatctggctgaatttgttggccttc
ggtgggctggaagccgttttcctgtggccgctggtgctgggtctttactgggaacgcgcc
aacgccaaaggcgcgctaagtgcgatgatcgttggcggcgtgctgtatgccgtactcgcg
acgctgaatattcagtacctgggcttccaccctatcgtgccctcgttactactaagtttg
ctggctttcctggtcggaaaccgtttcggtacatccgtcccgcaagctaccgttttgact
actgataaataa
              
                            

Download fasta file
RegulonDB