RegulonDB RegulonDB 10.10: Gene Sequence
parE gene sequence


Size: 1893        A: 445  T: 434  G: 561  C: 453

Fasta

 

>parE E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaaacttataacgctgatgccattgaggtactcaccgggcttgagccggttcgc
cgccgtccggggatgtataccgataccactcgccctaaccatttggggcaagaagtcatt
gataacagtgtggatgaagcactggcgggtcacgcaaaacgcgtggacgttattttacat
gctgaccagtcgttagaagttattgacgatgggcgcgggatgccggtggatattcacccg
gaagagggtgtaccggcggttgaactgattctttgccgtctgcatgcaggcggtaaattc
tctaacaaaaattaccagttctctggcggcctgcatggcgtggggatttcggtggttaac
gccctgtcgaagcgcgtagaagttaacgtgcgccgcgatggtcaggtttataacatcgcc
tttgaaaatggcgaaaaggtgcaggatttacaggttgtcggcacttgcggtaaacgcaat
actggtaccagtgtgcacttctggccggatgaaaccttctttgacagcccgcgattttct
gtttcacgcctgacgcatgtgctgaaagccaaagcggtattgtgccctggcgttgagatc
acttttaaagatgagatcaacaataccgaacaacgctggtgctatcaggacggtctgaat
gattacctggcggaagcggtaaatggtctgccgacgctgccggaaaaaccgtttatcggt
aatttcgctggtgatactgaagctgtggactgggcgctactgtggctgccggaaggcggt
gaactgctgaccgaaagctacgtcaaccttatcccaacgatgcagggcggtacccatgtt
aatggtctgcgtcagggcctgttggacgcgatgcgtgagttctgtgaataccgcaatatt
ctgccgcgcggtgtaaagctgtcggcggaagatatctgggatcgctgcgcctatgtgctg
tcagtaaaaatgcaggatccgcagtttgccgggcagacgaaagagcgtctctcttcgcgt
caatgcgcggcattcgtttctggcgtggtgaaagatgcctttatcctgtggctgaaccag
aacgttcaggcggctgaactgctggcggagatggcgatttccagcgcccagcgccgtatg
cgtgcggccaaaaaagtggtgcgtaaaaagctgaccagcggcccggcgttgcctggcaaa
ctggctgattgtaccgcgcaggaccttaaccgtaccgagctgttccttgtggaaggtgac
tccgcaggcggatctgccaagcaggcgcgcgatcgcgaatatcaggcgatcatgccactg
aaaggtaagatccttaacacctgggaagtctcttccgacgaagtgctggcttcgcaggaa
gtgcacgatatttcggtagcgatcggtatcgatcctgacagcgacgatctgagccagctt
cgttatggcaaaatctgtatcctcgcggatgcggactctgatggtctgcacattgccacg
ctgctctgcgctttgttcgtaaaacatttccgcgcgttggtgaaacacggtcacgtttac
gtcgcactgccaccgctctaccgtattgatctcgggaaagaggtttattacgcgctgacg
gaagaagagaaagagggcgtacttgagcaattaaaacgcaagaaaggcaagccgaacgtc
cagcgttttaaaggtctgggggaaatgaacccgatgcaattgcgcgaaaccacgcttgat
ccgaacactcgccgtctggtgcagttgactatcgatgatgaagacgatcagcgtactgac
gcgatgatggatatgctgctggcgaagaaacgctcggaagatcgccgcaactggttgcaa
gagaaaggcgacatggcggagattgaggtttaa
              
                            

Download fasta file
RegulonDB