RegulonDB RegulonDB 10.9: Gene Sequence
pcm gene sequence


Size: 627        A: 146  T: 146  G: 192  C: 143

Fasta

 

>pcm E. coli K12. Version NC_000913.3 GI:556503834
atggtaagcagacgcgtacaagcacttctggatcaattacgtgcgcaaggtattcaggat
gagcaggtgctgaatgcacttgccgccgtgccgcgtgaaaaattcgttgatgaagcgttt
gaacaaaaagcctgggacaatatcgctttgccgataggtcaggggcagacaatttcgcag
ccatatatggtggcgcgaatgaccgaattactcgagctgacgccgcagtcgcgggtgctg
gaaattggcaccggttcgggatatcaaacggcaatcctggcgcatcttgtccagcatgtt
tgctcggttgaacggattaaaggcttgcagtggcaggcacgtcgccgcctgaaaaatctt
gatttacataatgtttcaacccgtcatggcgatggatggcaaggttggcaggcacgtgcg
ccgtttgacgctatcattgttacggcggcaccgccggaaattccaactgcgctaatgacg
cagctggacgaaggcgggattctcgtcttacccgtaggggaggagcaccagtatttgaaa
cgggtgcgtcgtcggggaggcgaatttattatcgataccgtggaggccgtgcgctttgtc
cctttagtgaagggtgagctggcttaa
              
                            

Download fasta file
RegulonDB