RegulonDB RegulonDB 10.9: Gene Sequence
pcnB gene sequence


Size: 1398        A: 323  T: 294  G: 390  C: 391

Fasta

 

>pcnB E. coli K12. Version NC_000913.3 GI:556503834
atttttacccgagtcgctaatttttgccgcaaggtgctaagccgcgaggaaagcgaggct
gaacaggcagtcgcccgtccacaggtgacggtgatcccgcgtgagcagcatgctatttcc
cgcaaagatatcagtgaaaatgccctgaaggtaatgtacaggctcaataaagcgggatac
gaagcctggctggttggcggcggcgtgcgcgacctgttacttggcaaaaagccgaaagat
tttgacgtaaccactaacgccacgcctgagcaggtgcgcaaactgttccgtaactgccgc
ctggtgggtcgccgtttccgtctggctcatgtaatgtttggcccggagattatcgaagtt
gcgaccttccgtggacaccacgaaggtaacgtcagcgaccgcacgacctcccaacgcggg
caaaacggcatgttgctgcgcgacaacattttcggctccatcgaagaagacgcccagcgc
cgcgatttcactatcaacagcctgtattacagcgtagcggattttaccgtccgtgattac
gttggcggcatgaaggatctgaaggacggcgttatccgtctgattggtaacccggaaacg
cgctaccgtgaagatccggtacgtatgctgcgcgcggtacgttttgccgccaaattgggt
atgcgcatcagcccggaaaccgcagaaccgatccctcgcctcgctaccctgctgaacgat
atcccaccggcacgcctgtttgaagaatcgcttaaactgctacaagcgggctacggttac
gaaacctataagctgttgtgtgaatatcatctgttccagccgctgttcccgaccattacc
cgctacttcacggaaaatggcgacagcccgatggagcggatcattgaacaggtgctgaag
aataccgatacgcgtatccataacgatatgcgcgtgaacccggcgttcctgtttgccgcc
atgttctggtacccactgctggagacggcacagaagatcgcccaggaaagcggcctgacc
tatcacgacgctttcgcgctggcgatgaacgacgtgctggacgaagcctgccgttcactg
gcaatcccgaaacgtctgacgacattaacccgcgatatctggcagttgcagttgcgtatg
tcccgtcgtcagggtaaacgcgcatggaaactgctggagcatcctaagttccgtgcggct
tatgacctgttggccttgcgagctgaagttgagcgtaacgctgaactgcagcgtctggtg
aaatggtggggtgagttccaggtttccgcgccaccagaccaaaaagggatgctcaacgag
ctggatgaagaaccgtcaccgcgtcgtcgtactcgtcgtccacgcaaacgcgcaccacgt
cgtgagggtaccgcatga
              
                            

Download fasta file
RegulonDB