RegulonDB RegulonDB 10.9: Gene Sequence
pgpB gene sequence


Size: 765        A: 177  T: 201  G: 214  C: 173

Fasta

 

>pgpB E. coli K12. Version NC_000913.3 GI:556503834
atgcgttcgattgccagacgtaccgcagtgggagctgcactattgcttgtcatgccagta
gccgtatggatttctggctggcgttggcaacctggagaacaaagttggctactaaaagcg
gctttttgggttactgaaactgtcacccagccctggggcgtcattacacatttgatttta
ttcggctggtttctctggtgtctgcgttttcgcattaaggctgcctttgtattatttgcc
attctggcggccgcaatccttgtgggacaaggcgttaaatcctggatcaaagacaaagtc
caggaaccacgaccttttgttatctggctggaaaaaacacatcatattccggttgatgag
ttctacactttaaagcgagcagaacgcggaaatctagtgaaagaacagttggctgaagag
aaaaatatcccacaatatttgcgttcacactggcagaaagagacggggtttgcctttcct
tccggtcacacgatgtttgctgccagttgggcactgctggccgttggtttgctgtggccg
cgtcggcgaacgttaaccattgctatcttgctggtctgggcaacgggagtcatgggaagc
cgcctgctgctcgggatgcattggccacgcgatctggtagtagctacgttgatttcgtgg
gcgctggtggcggtggcaacgtggcttgcgcaacgaatttgtgggccattaacaccacct
gcggaagaaaatcgcgaaatagcgcaacgagaacaagaaagttaa
              
                            

Download fasta file
RegulonDB