RegulonDB RegulonDB 10.10: Gene Sequence
pgsA gene sequence


Size: 549        A: 94  T: 167  G: 157  C: 131

Fasta

 

>pgsA E. coli K12. Version NC_000913.3 GI:556503834
atgcaatttaatatccctacgttgcttacactgttccgtgtcatccttatcccattcttt
gtattggtcttttatctgcctgtcacctggtcgccgtttgccgccgcgctcattttctgc
gtcgcggcggtgactgactggttcgatggttttctggcacgccgctggaaccagagtacc
cggtttggtgctttccttgaccctgtggcagataaagttctcgtggctatcgccatggtg
ctggtaaccgagcattatcacagctggtgggtgacattaccggcggcaacgatgatcgcc
cgtgaaattattatttctgcgctacgcgaatggatggcggagttgggtaaacgcagtagc
gtggccgtctcctggattgggaaagtgaaaaccactgcccagatggtggcgttggcatgg
ctgctgtggcgtccgaacatttgggttgagtacgccggtattgcacttttctttgtggct
gcggtactgactctgtggtcaatgttgcaatatttgagcgctgcgcgtgcagatttgctt
gatcagtga
              
                            

Download fasta file
RegulonDB