RegulonDB RegulonDB 10.9: Gene Sequence
pheA gene sequence


Size: 1161        A: 307  T: 283  G: 284  C: 287

Fasta

 

>pheA E. coli K12. Version NC_000913.3 GI:556503834
atgacatcggaaaacccgttactggcgctgcgagagaaaatcagcgcgctggatgaaaaa
ttattagcgttactggcagaacggcgcgaactggccgtcgaggtgggaaaagccaaactg
ctctcgcatcgcccggtacgtgatattgatcgtgaacgcgatttgctggaaagattaatt
acgctcggtaaagcgcaccatctggacgcccattacattactcgcctgttccagctcatc
attgaagattccgtattaactcagcaggctttgctccaacaacatctcaataaaattaat
ccgcactcagcacgcatcgcttttctcggccccaaaggttcttattcccatcttgcggcg
cgccagtatgctgcccgtcactttgagcaattcattgaaagtggctgcgccaaatttgcc
gatatttttaatcaggtggaaaccggccaggccgactatgccgtcgtaccgattgaaaat
accagctccggtgccataaacgacgtttacgatctgctgcaacataccagcttgtcgatt
gttggcgagatgacgttaactatcgaccattgtttgttggtctccggcactactgattta
tccaccatcaatacggtctacagccatccgcagccattccagcaatgcagcaaattcctt
aatcgttatccgcactggaagattgaatataccgaaagtacgtctgcggcaatggaaaag
gttgcacaggcaaaatcaccgcatgttgctgcgttgggaagcgaagctggcggcactttg
tacggtttgcaggtactggagcgtattgaagcaaatcagcgacaaaacttcacccgattt
gtggtgttggcgcgtaaagccattaacgtgtctgatcaggttccggcgaaaaccacgttg
ttaatggcgaccgggcaacaagccggtgcgctggttgaagcgttgctggtactgcgcaac
cacaatctgattatgacccgtctggaatcacgcccgattcacggtaatccatgggaagag
atgttctatctggatattcaggccaatcttgaatcagcggaaatgcaaaaagcattgaaa
gagttaggggaaatcacccgttcaatgaaggtattgggctgttacccaagtgagaacgta
gtgcctgttgatccaacctga
              
                            

Download fasta file
RegulonDB