RegulonDB RegulonDB 10.9: Gene Sequence
pheT gene sequence


Size: 2388        A: 553  T: 537  G: 710  C: 588

Fasta

 

>pheT E. coli K12. Version NC_000913.3 GI:556503834
atgaaattcagtgaactgtggttacgcgaatgggtgaacccggcgattgatagcgatgcg
ctggcaaatcaaatcactatggcgggcctggaagttgacggtgtagaaccggttgccggc
agcttccacggcgtggtcgttggtgaagtggttgagtgtgcgcagcatccgaacgctgac
aaactgcgtgtgacaaaagtgaatgtcggcggcgatcgcctgctggacatcgtctgcggt
gcgccaaactgccgtcagggcctgcgtgtagcggtagcgaccattggtgctgttctgccg
ggtgatttcaaaattaaagcggcgaaactgcgtggcgaaccgtctgaagggatgctgtgc
tccttctctgaactgggcatttctgacgatcacagcggcattatcgaactgcctgcggat
gcgccgattggcaccgatatccgtgaatacctgaaacttgatgacaacaccatcgaaatc
agcgtgacgccaaaccgtgccgactgcttaggcatcattggtgttgcgcgtgacgttgcc
gtgctgaaccagctgccgctggttcaaccggaaatcgttccggttggtgcgaccatcgac
gacacgctgccgattacagtcgaagcgccggaagcctgcccgcgttatcttggccgtgtg
gtaaaaggcattaacgttaaagcgccaactccgctgtggatgaaagaaaaactgcgtcgt
tgcgggatccgttctatcgatgcagttgttgacgtcaccaactatgtgctgctcgaactg
ggccagccgatgcacgctttcgataaagatcgcattgaaggcggcattgtggtgcggatg
gcgaaagagggcgaaacgctggtgctgctcgacggtactgaagcgaagctgaatgctgac
actctggtcatcgccgaccacaacaaggcgctggcgatgggcggcatcttcggtggcgaa
cactctggcgtgaatgacgaaacacaaaacgtgctgctggaatgcgcgttctttagcccg
ctgtctatcaccggtcgtgctcgtcgtcatggcctgcataccgatgcgtctcaccgttat
gagcgtggcgttgatccggcactgcagcacaaagcgatggaacgtgcgacccgtctgctg
atcgacatctgcggtggtgaggctggcccggtaattgatatcaccaacgaagcaacgctg
ccgaagcgtgcaaccatcactctacgtcgtagcaaactggatcgcctgatcggccatcat
attgcggatgagcaggtaactgacattctgcgtcgtctcggctgcgaagtgaccgaaggc
aaagacgaatggcaggcagttgcgccgagctggcgtttcgatatggagattgaagaagat
ctggttgaagaagtcgcgcgtgtttacggctacaacaacatcccggatgagccggtacag
gcaagcctgattatgggtactcaccgtgaagctgacctgtcgctcaagcgcgtgaaaacg
ctgctcaacgacaaaggctatcaggaagtgatcacctacagcttcgttgatccgaaagtg
cagcagatgatccatccaggcgttgaagccttactgctgccaagcccgatctctgttgaa
atgtcagcaatgcgtctttctctgtggactggcctgctggcaaccgtggtgtacaaccag
aaccgtcagcagaaccgtgtgcgcattttcgaaagcggtctgcgtttcgtaccagatact
caggcaccgttgggcattcgtcaggatctgatgttagccggtgtgatttgcggtaaccgt
tacgaagagcactggaacctggcaaaagagaccgttgatttctatgatttgaaaggcgat
cttgaatccgttctcgacctgaccggtaaactgaatgaggttgagttccgtgcagaagcg
aatccggcactgcatccggggcaatccgcagcgatttatctgaaaggtgaacgtattggt
tttgttggggttgttcatcctgaactggaacgtaaactggatcttaacggtcgcactctg
gtgttcgaactggagtggaacaagctcgcagaccgcgtggtgcctcaggcgcgcgagatt
tctcgcttcccggcgaaccgtcgtgacatcgcggtggtggtcgcagaaaacgttcccgca
gcggatattttatccgaatgtaagaaagttggcgtaaatcaggtagttggcgtaaactta
tttgacgtgtaccgcggtaagggtgttgcggaggggtataagagcctcgccataagcctg
atcctgcaagataccagccgtacactcgaagaagaggagattgccgctaccgtcgccaaa
tgtgtagaggcattaaaagagcgattccaggcatcattgagggattga
              
                            

Download fasta file
RegulonDB