RegulonDB RegulonDB 10.9: Gene Sequence
creC gene sequence


Size: 1425        A: 312  T: 345  G: 424  C: 344

Fasta

 

>creC E. coli K12. Version NC_000913.3 GI:556503834
atgcgtatcggcatgcggttgttgctgggctattttttactggtggcggtggcagcctgg
ttcgtactggccatttttgtcaaagaagttaaaccgggcgtgcgaagagcaacggagggg
acgttgatcgacaccgcaacgttgctggcggagctggcgcgtcccgatttgctctctggg
gacccaacgcatgggcaactggcgcaggcgtttaatcagctacaacatcgcccgtttcgc
gccaatatcggtggcattaacaaagtgcgcaatgaatatcatgtctatatgaccgatgcg
cagggcaaagtattgttcgattcggcaaataaagccgttggacaggattattcgcgctgg
aatgacgtctggctaacgttgcgtggtcagtatggtgcgcgcagcacgttgcaaaatcct
gccgatcccgaaagttctgtgatgtatgttgccgcaccgattatggacggctcgcggctt
attggcgttttgagcgtaggcaaaccgaacgcggcgatggctccggtcattaagcgtagc
gagcggcgaattttatgggccagcgccattttgttggggattgcactggtgattggcgca
ggcatggtttggtggatcaaccgctctattgcccggctcactcgctatgctgattccgtc
actgacaataagcccgttcctctccccgatctcggtagtagcgagttgcgtaaactcgcg
caggcgctggaaagtatgcgcgtgaagctggaagggaaaaactatattgagcagtatgtt
tacgcattaactcatgagctaaaaagcccactggcggcgattcgtggagcggcggaaatt
ttacgcgaaggtccgccgccggaagtggtggctcgttttactgacaacattctgacgcaa
aatgcgcgtatgcaggcattggtagaaacgttactacgccaggcaagactggagaatcgt
caggaagtcgttctgactgctgttgatgtggcggcattattccgccgcgtcagcgaagcg
cgcaccgtgcagttggcagaaaaaaaaatcactctgcatgttacgcccaccgaggttaac
gttgctgctgaaccggcgttactggagcaggcgctgggaaatttactggataacgccatc
gattttacccccgagagcggttgcatcacgctaagcgccgaagtggatcaggaacacgtc
acgcttaaggtgctggataccggtagtggtattcctgactacgcgctttcacgtattttt
gaacgcttttactctttgcctcgtgcaaatgggcaaaaaagcagcggtctggggttggcg
ttcgtcagtgaggtcgcccgtttgtttaacggcgaagtcacgctgcgcaacgtgcaggaa
ggtggcgtgctggcctcgcttcgacttcaccgtcacttcacatag
              
                            

Download fasta file
RegulonDB