RegulonDB RegulonDB 10.9: Gene Sequence
phoR gene sequence


Size: 1296        A: 308  T: 301  G: 376  C: 311

Fasta

 

>phoR E. coli K12. Version NC_000913.3 GI:556503834
gtgctggaacggctgtcgtggaaaaggctggtgctggagctgctactttgctgcctcccg
gctttcatcctgggtgcattttttggttacctgccctggtttttgctggcatcggtaaca
ggactgcttatctggcatttctggaatttattgcgcctttcatggtggctgtgggtggat
cgcagtatgaccccgccaccggggcgtggtagctgggaaccgctactatacggcttacac
cagatgcagctgcgaaataaaaaacgccgccgtgaactgggcaatctgattaaacgcttt
cgtagcggcgcggagtcgctgcccgacgcggtggtgctgaccacggaagagggcggtatt
ttctggtgtaacggtctggcgcaacaaattcttggtttgcgctggccggaagataacggg
cagaacatccttaacctactgcgttacccggagtttacgcaatatctgaaaacgcgtgat
ttttctcgcccgctcaatctggtgctcaacaccgggcggcatctggaaattcgcgtcatg
ccttatacccacaaacagttgctgatggtggcgcgtgatgtcacgcaaatgcatcaactg
gaaggggcgcggcgtaacttttttgccaacgtgagccatgagttacgtacgccattgacc
gtgttacagggttacctggagatgatgaatgagcagccgctggaaggcgcggtacgcgaa
aaagcgttgcacaccatgcgcgagcagacccagcggatggaaggactggtgaagcaattg
ctgacgctgtcgaaaatagaagccgcaccgacgcatttgctcaatgaaaaggttgatgtg
ccgatgatgctgcgcgttgttgagcgcgaggctcagactctgagtcagaaaaaacagaca
tttacctttgagatagataacggcctcaaggtgtctggcaacgaagatcagctacgcagt
gcgatttcgaacctggtctataacgccgtgaatcatacgccggaaggcacgcatatcacc
gtacgctggcagcgagtgccgcacggtgccgaatttagcgttgaagataacggaccgggc
attgcaccggagcatattccgcgcctgaccgagcgtttttatcgcgttgataaagcgcgt
tcccggcaaaccggcggtagcggattagggttagcgatcgtgaaacatgctgtgaatcat
cacgaaagtcgcctgaatattgagagtacagtaggaaaaggaacacgtttcagttttgtt
atcccggaacgtttaattgccaaaaacagcgattaa
              
                            

Download fasta file
RegulonDB