RegulonDB RegulonDB 10.9: Gene Sequence
pinE gene sequence


Size: 555        A: 152  T: 132  G: 159  C: 112

Fasta

 

>pinE E. coli K12. Version NC_000913.3 GI:556503834
atgcttattggctatgtacgcgtatcaacaaatgaccagaacacagatctacaacgtaat
gcgctgaactgtgcaggatgcgagctgatttttgaagacaagataagcggcacaaagtcc
gaaaggccgggactgaaaaaactgctcaggacattatcggcaggtgacactctggttgtc
tggaagctggatcggctggggcgtagtatgcggcatcttgtcgtgctggtggaggagttg
cgcgaacgaggcatcaactttcgtagtctgacggattcaattgataccagcacaccaatg
ggacgctttttctttcatgtgatgggtgccctggctgaaatggagcgtgaactgattgtt
gaacgaacaaaagctggactggaaactgctcgtgcacagggacgaattggtggacgtcgt
cccaaacttacaccagaacaatgggcacaagctggacgattaattgcagcaggaactcct
cgccagaaggtggcgattatctatgatgttggtgtgtcaactttgtataagaggtttcct
gcaggggataaataa
              
                            

Download fasta file
RegulonDB