RegulonDB RegulonDB 10.8: Gene Sequence
pnp gene sequence


Size: 2136        A: 505  T: 476  G: 607  C: 548

Fasta

 

>pnp E. coli K12. Version NC_000913.3 GI:556503834
ttgcttaatccgatcgttcgtaaattccagtacggccaacacaccgtgactctggaaacc
ggcatgatggctcgtcaggctactgccgctgttatggttagcatggatgacaccgcggta
ttcgttaccgttgttggccagaaaaaagccaaaccaggtcaggacttcttcccactgacc
gttaactatcaggagcgtacctacgctgctggtcgtatcccgggtagcttcttccgtcgt
gaaggccgcccaagcgaaggcgaaaccctgatcgcgcgtctgattgaccgcccgattcgc
ccgctgttcccggaaggcttcgtcaacgaagttcaggttatcgccaccgtggtttctgtt
aacccgcaagttaacccggatatcgtcgcgatgattggtgcttccgcagcgctgtctctg
tctggtattccgttcaatggcccgattggtgctgcccgcgtaggttacatcaatgaccag
tacgtactgaacccgactcaggacgagctgaaagagagcaaactggatctggttgttgcc
ggtactgaagccgctgtactgatggttgaatctgaagctcaactgctgagcgaagaccag
atgctgggcgcagtagtgttcggtcatgaacaacagcaggttgttattcagaacatcaat
gaactggtgaaagaagccggtaaaccgcgttgggactggcagccggagccggtaaacgaa
gcgctaaacgcgcgcgttgctgcactggctgaagctcgcctgagcgatgcttaccgcatc
accgacaaacaagagcgttatgcgcaggttgatgtcatcaaatctgaaaccatcgcgacg
ctgcttgctgaagacgaaaccctggacgaaaacgaactgggtgaaattctgcacgcgatc
gagaaaaacgttgttcgtagccgcgtactggcaggcgaaccgcgtatcgacggtcgtgaa
aaagatatgatccgtggtctggatgtgcgtactggcgtgctgccgcgtactcacggttct
gcgctgttcacccgtggtgaaacgcaggcgctggttaccgcaacgctgggtactgctcgt
gacgcgcaggttcttgatgaactgatgggcgaacgtaccgataccttcctgttccactac
aacttccctccgtactccgtaggcgaaaccggcatggtcggttctccgaagcgtcgtgaa
attggtcacggtcgtctggcgaagcgcggcgtgctggcagtcatgccggatatggacaaa
ttcccgtacaccgtacgtgttgtgtctgaaatcactgaatccaacggttcctcttctatg
gcttccgtgtgcggcgcgtctctggcgctgatggacgcaggtgtgccgatcaaagctgcc
gttgcgggtatcgcaatgggtctggtgaaagaaggcgacaactacgttgtactgtctgac
attttgggcgacgaagatcacctgggcgatatggacttcaaagttgcaggttcccgcgac
ggtatctctgcactgcagatggatatcaaaattgaaggtatcaccaaagagatcatgcag
gttgcgctgaaccaggctaaaggtgcgcgtctgcatatcctgggcgtaatggaacaggcg
atcaacgcgccgcgtggcgatatctctgagttcgcaccgcgtatccataccatcaagatc
aacccggacaagatcaaagatgttatcggtaaaggcggttctgtaatccgtgctctgacc
gaagaaactggcaccaccatcgaaatcgaagatgacggtactgtgaagattgcagcgacc
gacggcgagaaagcgaaacatgctattcgtcgtatcgaagagatcactgcagaaatcgaa
gtgggccgcgtctacactggtaaagtgacccgtatcgttgactttggcgcatttgttgcc
atcggcggcggtaaagaaggtctggtccacatctctcaaatcgctgacaaacgcgttgag
aaagtgaccgattacctgcagatgggtcaggaagtaccggtgaaagttctggaagttgat
cgccagggccgtatccgtctgagcattaaagaagcgactgagcagtctcaacctgctgca
gcaccggaagctccggctgctgaacagggcgagtaa
              
                            

Download fasta file
RegulonDB