RegulonDB RegulonDB 10.9: Gene Sequence
pntB gene sequence


Size: 1389        A: 292  T: 366  G: 411  C: 320

Fasta

 

>pntB E. coli K12. Version NC_000913.3 GI:556503834
atgtctggaggattagttacagctgcatacattgttgccgcgatcctgtttatcttcagt
ctggccggtctttcgaaacatgaaacgtctcgccagggtaacaacttcggtatcgccggg
atggcgattgcgttaatcgcaaccatttttggaccggatacgggtaatgttggctggatc
ttgctggcgatggtcattggtggggcaattggtatccgtctggcgaagaaagttgaaatg
accgaaatgccagaactggtggcgatcctgcatagcttcgtgggtctggcggcagtgctg
gttggctttaacagctatctgcatcatgacgcgggaatggcaccgattctggtcaatatt
cacctgacggaagtgttcctcggtatcttcatcggggcggtaacgttcacgggttcggtg
gtggcgttcggcaaactgtgtggcaagatttcgtctaaaccattgatgctgccaaaccgt
cacaaaatgaacctggcggctctggtcgtttccttcctgctgctgattgtatttgttcgc
acggacagcgtcggcctgcaagtgctggcattgctgataatgaccgcaattgcgctggta
ttcggctggcatttagtcgcctccatcggtggtgcagatatgccagtggtggtgtcgatg
ctgaactcgtactccggctgggcggctgcggctgcgggctttatgctcagcaacgacctg
ctgattgtgaccggtgcgctggtcggttcttcgggggctatcctttcttacattatgtgt
aaggcgatgaaccgttcctttatcagcgttattgcgggtggtttcggcaccgacggctct
tctactggcgatgatcaggaagtgggtgagcaccgcgaaatcaccgcagaagagacagcg
gaactgctgaaaaactcccattcagtgatcattactccggggtacggcatggcagtcgcg
caggcgcaatatcctgtcgctgaaattactgagaaattgcgcgctcgtggtattaatgtg
cgtttcggtatccacccggtcgcggggcgtttgcctggacatatgaacgtattgctggct
gaagcaaaagtaccgtatgacatcgtgctggaaatggacgagatcaatgatgactttgct
gataccgataccgtactggtgattggtgctaacgatacggttaacccggcggcgcaggat
gatccgaagagtccgattgctggtatgcctgtgctggaagtgtggaaagcgcagaacgtg
attgtctttaaacgttcgatgaacactggctatgctggtgtgcaaaacccgctgttcttc
aaggaaaacacccacatgctgtttggtgacgccaaagccagcgtggatgcaatcctgaaa
gctctgtaa
              
                            

Download fasta file
RegulonDB