RegulonDB RegulonDB 10.9: Gene Sequence
polB gene sequence


Size: 2352        A: 533  T: 517  G: 659  C: 643

Fasta

 

>polB E. coli K12. Version NC_000913.3 GI:556503834
gtggcgcaggcaggttttatcttaacccgacactggcgggacaccccgcaagggacagaa
gtctccttctggctggcgacggacaacgggccgttgcaggttacgcttgcaccgcaagag
tccgtggcgtttattcccgccgatcaggttccccgcgctcagcatattttgcagggtgaa
caaggctttcgcctgacaccgctggcgttaaaggattttcaccgccagccggtgtatggc
ctttactgtcgcgcccatcgccaattgatgaattacgaaaagcgcctgcgtgaaggtggc
gttaccgtctacgaggccgatgtgcgtccgccagaacgctatctgatggagcggtttatc
acctcaccggtgtgggtcgagggtgatatgcacaatggcactatcgttaatgcccgtctg
aaaccgcatcccgactatcgtccgccgctcaagtgggtttctatagatattgaaaccacc
cgccacggtgagctgtactgcatcggcctggaaggctgcgggcagcgcatcgtttatatg
ctggggccggagaatggcgacgcctcctcgcttgatttcgaactggaatacgtcgccagc
cgcccgcagttgctggaaaaactcaacgcctggtttgccaactacgatcctgatgtgatc
atcggttggaacgtggtgcagttcgatctgcgaatgctgcaaaaacatgccgagcgttac
cgtcttccgctgcgtcttgggcgcgataatagcgagctggagtggcgcgagcacggcttt
aaaaacggcgtcttttttgcccaggctaaaggtcggctaattatcgacggtatcgaggcg
ctgaaatccgcgttctggaatttctcttcattctcgctggaaactgtcgctcaggagcta
ttaggcgaaggaaaatctatcgataacccgtgggatcgaatggacgaaattgaccgccgt
ttcgccgaagataaacctgcgctggcaacttataacctgaaagattgcgagctggtgacg
cagatcttccacaaaactgaaatcatgccatttttactcgaacgggcaacggtgaacggc
ctgccggtggaccgacacggcggttcggtggcggcatttggtcatctctattttccgcga
atgcatcgcgctggttatgtcgcgcctaatctcggcgaagtgccgccgcacgccagccct
ggcggctacgtgatggattcacggccagggctttatgattcagtgctggtgctggactat
aaaagcctgtacccgtcgatcatccgcacctttctgattgatcccgtcgggctggtggaa
ggcatggcgcagcctgatccagagcacagtaccgaaggttttctcgatgcctggttctcg
cgagaaaaacattgcctgccggagattgtgactaacatctggcacgggcgcgatgaagcc
aaacgccagggtaacaaaccgctgtcgcaggcgctgaaaatcatcatgaatgccttttat
ggcgtgctcggcaccaccgcctgccgcttcttcgatccgcggctggcatcgtcgatcacc
atgcgtggtcatcagatcatgcggcaaaccaaagcgttgattgaagcacagggctacgac
gttatctacggcgataccgactcaacgtttgtctggctgaaaggcgcacattcggaagaa
gaagcggcgaaaatcggtcgtgcactggtgcagcacgttaacgcctggtgggcggaaacg
ctgcaaaaacaacggctgaccagcgcattagaactggagtatgaaacccatttctgccgt
tttctgatgccaaccattcgcggagccgataccggcagtaaaaagcgttatgccggactg
attcaggagggcgacaagcagcggatggtgtttaaagggctggaaaccgtgcgcaccgac
tggacgccgctggcccagcagtttcagcaggagctatacctgcgcatcttccgcaacgag
ccatatcaggaatatgtacgcgaaaccatcgacaaactgatggcgggtgaactggatgcg
cgactggtttaccgtaaacgccttcgccgtccgctgagcgagtatcagcgtaatgtgccg
cctcatgtacgcgccgctcgccttgccgatgaagaaaaccaaaagcgtggtcgccccttg
caatatcagaatcgcggcaccattaagtacgtatggaccaccaacggcccggagccgctg
gactaccaacgttcaccactggattacgaacactatctgacccgccagctacaacccgtg
gcggagggaatactcccttttattgaggataattttgctacacttatgaccgggcaactt
gggctattttga
              
                            

Download fasta file
RegulonDB