RegulonDB RegulonDB 11.1: Gene Sequence
potA gene sequence


Size: 1137        A: 298  T: 261  G: 300  C: 278

Fasta

 

>potA E. coli K12. Version NC_000913.3 GI:556503834
atgggacagagtaaaaaattgaataaacaaccgagttcgctttcaccgctggtgcaattg
gcgggaattcgcaaatgctttgatggtaaagaggtcattccccagctggatctgactatc
aacaatggcgagttcctcacgctgcttggcccttctggctgcggtaaaacaaccgttctt
cgcctgattgcaggtctggaaactgttgattccggacgcatcatgctggataacgaggac
atcacccacgttccggcggaaaaccgctatgtgaacactgttttccaaagctacgcactt
ttcccccacatgaccgtgttcgaaaatgtggcctttgggttgcgcatgcaaaaaaccccc
gctgctgaaattacgccccgcgtgatggaagccctgcggatggtgcagttggaaaccttc
gctcaacgcaaaccgcatcagctctctggtggtcaacagcaacgcgtcgccattgctcgc
gcggtggttaacaagcctcgtctgttgttgctggatgagtcgctctcagcgctggattac
aaactgcgtaagcaaatgcagaacgagctgaaagcgttacagcgtaagcttggcattaca
ttcgtctttgtgactcacgaccaggaagaagcactcaccatgtcagacaggattgtggtg
atgcgcgatggtcgcattgagcaagacggcacgccgcgtgaaatctacgaagagccgaaa
aacctgtttgttgccggcttcattggcgaaatcaatatgtttaacgccactgtcatcgaa
cgtctagacgagcagcgcgtacgcgccaacgttgaaggccgcgaatgtaatatctacgtt
aacttcgccgttgaaccggggcaaaaactgcatgttctgctgcgcccggaagacttacgt
gttgaagagattaacgacgacaaccacgctgaagggctgattggttacgttcgcgagcgt
aactacaaaggcatgacgctggagtcggttgttgaactggaaaatggcaagatggtgatg
gtcagcgaattcttcaatgaagacgatcctgactttgaccactctctcgaccaaaaaatg
gccattaattgggtagaaagctgggaggtcgtactggctgatgaagaacacaagtaa
              
                            

Download fasta file
RegulonDB