RegulonDB RegulonDB 10.9: Gene Sequence
potD gene sequence


Size: 1047        A: 300  T: 215  G: 275  C: 257

Fasta

 

>potD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaatggtcacgccacctgctcgcggcgggtgctctggcactgggcatgagcgcc
gctcacgccgatgacaacaacacgctgtatttctacaactggaccgagtacgtgccgcca
ggactgcttgaacagttcaccaaagaaaccggtattaaggttatctattcgacttacgag
tcgaacgaaaccatgtacgccaagctgaaaacatacaaagacggtgcctatgatctggtg
gttccttcaacctattacgttgataaaatgcgtaaagaagggatgatccagaagatcgac
aagtcgaagttaacaaacttcagcaatctcgatccagacatgctcaacaagccttttgac
ccgaataacgactactccattccgtatatctggggtgcgacggcgattggtgttaacggt
gatgcggtggatccgaaatctgtcaccagctgggccgatctgtggaagccagagtacaaa
ggcagcctgctgttgaccgacgatgcccgtgaagtgttccagatggcgctgcgtaagctg
ggctactccggtaacaccaccgatccgaaagagattgaagctgcatataacgagctgaaa
aaactgatgccaaacgtggcagcctttaactccgataacccggcgaacccgtacatggaa
ggcgaagttaacctcggcatgatctggaacggttctgctttcgttgcacgccaggcgggt
acgccaattgacgtggtgtggccgaaagaaggcggcattttctggatggacagcctggcg
atcccggcaaatgccaaaaacaaagaaggcgcgctgaaattgatcaacttcctgctgcgc
ccggatgtggcaaaacaggttgctgaaactatcggttatccaacgccaaaccttgcggcg
cgtaagctgttaagtccagaagtggcgaacgataaaacactctacccggatgctgaaacc
attaaaaatggcgaatggcagaatgacgttggcgcagccagcagcatttatgaagagtat
tatcagaagctgaaagcaggacgttaa
              
                            

Download fasta file
RegulonDB