RegulonDB RegulonDB 10.9: Gene Sequence
potE gene sequence


Size: 1320        A: 278  T: 374  G: 365  C: 303

Fasta

 

>potE E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaggctaaatcgaacaaaatgggcgtcgttcagttaaccatactgacgatggtc
aacatgatgggctccggtatcatcatgctgccgacaaagcttgccgaagtcgggacaatc
tcaattatctcctggctggtgacagccgtaggctcaatggcactggcatgggcattcgca
aaatgcggtatgttcagccgtaaatcaggcggtatgggcggttatgccgagtatgctttc
ggtaaatccggtaactttatggcgaactatacctacggcgtctcactgctgattgctaac
gtcgcgattgctatttcggcggttggttacggcaccgaactgctcggcgcgagtttgtcg
ccagtgcagattggtcttgcgaccatcggggtgctgtggatttgtaccgtggctaacttt
ggtggtgcgcgcattaccgggcaaatcagtagcattaccgtgtggggggtcattattccg
gtcgtcggtctgtgcattattggctggttctggtttagcccgacgctgtacgttgattcc
tggaatccgcatcatgcaccgttcttcagtgcggtaggttcttccatcgctatgacgctg
tgggcttttcttggtctggagtctgcgtgtgcgaatactgatgtagtggaaaacccggaa
cgtaatgtgccaatcgcggtactcggcggtacgttaggtgcggcggtgatttatatcgtc
tccaccaacgtgattgccgggattgtgccaaatatggagctggcaaattcaacggcacca
tttggtctggccttcgcgcagatgttcacgccggaagtgggtaaagtcattatggcgctg
atggtgatgtcctgctgcggttcgctacttggctggcagttcaccattgcccaggtgttt
aaatcttcatctgatgaaggctacttccctaaaattttctcccgtgtaaccaaagtggat
gcaccggtgcagggaatgttgaccattgtgattattcagagtggattggcactgatgacc
attagcccgtcgctaaacagtcagttcaacgtgctggttaacctggccgtggtgaccaat
atcattccgtatattctgtcaatggcggcattagtcattattcagaaggtcgctaatgtg
cccccctcaaaagcgaaagttgcaaactttgttgcttttgttggcgcgatgtatagcttt
tatgcgctgtactcatccggggaagaagccatgctgtacggttccatcgtgaccttcctt
ggttggacactgtatggtctggtatcaccacgctttgaactgaaaaataaacacggttaa
              
                            

Download fasta file
RegulonDB