RegulonDB RegulonDB 10.9: Gene Sequence
ppiA gene sequence


Size: 573        A: 144  T: 136  G: 140  C: 153

Fasta

 

>ppiA E. coli K12. Version NC_000913.3 GI:556503834
atgttcaaatcgaccctggcggcgatggctgctgttttcgctctttctgctctttctccc
gcagcaatggcagcgaaaggggacccgcacgtattgttgacaacctcagctggtaacatc
gaactggagctggataaacaaaaagcgccagtgtctgtgcaaaactttgtcgattatgtg
aacagcggtttttataacaacactacctttcaccgcgtcattcctggctttatgattcag
ggcggcggtttcaccgagcagatgcagcagaaaaaaccaaacccgccaatcaaaaatgaa
gccgataacggcctgcgcaacacgcgtggcaccatcgcgatggcacgtaccgctgacaaa
gacagcgccaccagccagttctttatcaacgttgccgataacgccttccttgaccatggt
cagcgtgatttcggttacgcggtatttggtaaagtggtgaaaggcatggacgttgccgat
aagatttcccaggtgccgactcatgacgttggtccgtaccagaatgtgccgtcaaaaccg
gtagttatcctttccgctaaagtcctgccgtaa
              
                            

Download fasta file
RegulonDB